\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1129006509:

Variant ID: vg1129006509 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 29006509
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGGACCCGATTTCTTGGGCGGCGGGGGGTTTGGGCGACGAACTGCGAGCGGTAGAAGCACGGCTTGGTGTAGTCGTCGTGCAGGTGCTGGCGAGTTCGAC[G/A]
CGGGCCGGCTCCGGCGAGGAGGTGGCAAGTATCGGCGAAGGGGCGGCGGCGACACTCCTGTGTCGGGGAGAAGGCTTCCGTGGGCGTTGGCATCCTCACC

Reverse complement sequence

GGTGAGGATGCCAACGCCCACGGAAGCCTTCTCCCCGACACAGGAGTGTCGCCGCCGCCCCTTCGCCGATACTTGCCACCTCCTCGCCGGAGCCGGCCCG[C/T]
GTCGAACTCGCCAGCACCTGCACGACGACTACACCAAGCCGTGCTTCTACCGCTCGCAGTTCGTCGCCCAAACCCCCCGCCGCCCAAGAAATCGGGTCCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.50% 0.90% 3.07% 10.56% NA
All Indica  2759 78.80% 0.10% 3.99% 17.14% NA
All Japonica  1512 95.00% 2.60% 1.79% 0.60% NA
Aus  269 95.20% 0.00% 2.23% 2.60% NA
Indica I  595 94.50% 0.00% 0.17% 5.38% NA
Indica II  465 86.00% 0.00% 1.08% 12.90% NA
Indica III  913 63.00% 0.00% 9.09% 27.93% NA
Indica Intermediate  786 80.90% 0.40% 2.67% 16.03% NA
Temperate Japonica  767 96.00% 1.30% 2.09% 0.65% NA
Tropical Japonica  504 93.70% 4.40% 1.19% 0.79% NA
Japonica Intermediate  241 95.00% 2.90% 2.07% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 0.00% 2.22% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1129006509 G -> A LOC_Os11g48100.1 synonymous_variant ; p.Thr37Thr; LOW synonymous_codon Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1129006509 G -> DEL LOC_Os11g48100.1 N frameshift_variant Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1129006509 G A -0.03 -0.03 -0.04 -0.02 -0.02 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1129006509 NA 7.39E-06 mr1517_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1129006509 1.11E-06 NA mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1129006509 3.32E-07 NA mr1962_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251