\
| Variant ID: vg1128944786 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 28944786 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 254. )
ATGAACATGGTGGTGCTACAGTAAACATTTGCTAATGATGGATTAACTAGGCTTAATATATTCGTCTCACAGTTTATAGGCGAAATATGTAATTTATTTT[G/A]
TTATTAGTCTACATTTAATACTTCAAATGCGTGTCCGTATACGTCAAAAGTTTTTATTTTTTGCTAAAACAACTAAATACGGCCGGAGTAGCAATGTGCA
TGCACATTGCTACTCCGGCCGTATTTAGTTGTTTTAGCAAAAAATAAAAACTTTTGACGTATACGGACACGCATTTGAAGTATTAAATGTAGACTAATAA[C/T]
AAAATAAATTACATATTTCGCCTATAAACTGTGAGACGAATATATTAAGCCTAGTTAATCCATCATTAGCAAATGTTTACTGTAGCACCACCATGTTCAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.70% | 42.30% | 0.06% | 0.00% | NA |
| All Indica | 2759 | 31.80% | 68.10% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 95.80% | 4.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 10.10% | 89.70% | 0.17% | 0.00% | NA |
| Indica II | 465 | 14.80% | 85.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 52.80% | 47.10% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 34.00% | 66.00% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 94.00% | 5.90% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 66.70% | 33.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1128944786 | G -> A | LOC_Os11g47980.1 | upstream_gene_variant ; 4879.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg1128944786 | G -> A | LOC_Os11g47990.1 | upstream_gene_variant ; 3831.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg1128944786 | G -> A | LOC_Os11g48000.1 | downstream_gene_variant ; 2513.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg1128944786 | G -> A | LOC_Os11g47990-LOC_Os11g48000 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1128944786 | NA | 1.17E-33 | mr1026 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128944786 | NA | 3.14E-33 | mr1161 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128944786 | NA | 1.50E-08 | mr1260 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128944786 | NA | 4.57E-15 | mr1870 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128944786 | NA | 5.30E-49 | mr1063_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128944786 | NA | 3.30E-35 | mr1161_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128944786 | NA | 1.79E-19 | mr1180_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128944786 | NA | 1.40E-06 | mr1180_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128944786 | NA | 4.05E-21 | mr1183_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128944786 | NA | 1.31E-17 | mr1870_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |