\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128944786:

Variant ID: vg1128944786 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 28944786
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


ATGAACATGGTGGTGCTACAGTAAACATTTGCTAATGATGGATTAACTAGGCTTAATATATTCGTCTCACAGTTTATAGGCGAAATATGTAATTTATTTT[G/A]
TTATTAGTCTACATTTAATACTTCAAATGCGTGTCCGTATACGTCAAAAGTTTTTATTTTTTGCTAAAACAACTAAATACGGCCGGAGTAGCAATGTGCA

Reverse complement sequence

TGCACATTGCTACTCCGGCCGTATTTAGTTGTTTTAGCAAAAAATAAAAACTTTTGACGTATACGGACACGCATTTGAAGTATTAAATGTAGACTAATAA[C/T]
AAAATAAATTACATATTTCGCCTATAAACTGTGAGACGAATATATTAAGCCTAGTTAATCCATCATTAGCAAATGTTTACTGTAGCACCACCATGTTCAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.70% 42.30% 0.06% 0.00% NA
All Indica  2759 31.80% 68.10% 0.07% 0.00% NA
All Japonica  1512 95.80% 4.20% 0.07% 0.00% NA
Aus  269 92.20% 7.80% 0.00% 0.00% NA
Indica I  595 10.10% 89.70% 0.17% 0.00% NA
Indica II  465 14.80% 85.20% 0.00% 0.00% NA
Indica III  913 52.80% 47.10% 0.11% 0.00% NA
Indica Intermediate  786 34.00% 66.00% 0.00% 0.00% NA
Temperate Japonica  767 94.00% 5.90% 0.13% 0.00% NA
Tropical Japonica  504 97.00% 3.00% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 1.20% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 66.70% 33.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1128944786 G -> A LOC_Os11g47980.1 upstream_gene_variant ; 4879.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1128944786 G -> A LOC_Os11g47990.1 upstream_gene_variant ; 3831.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1128944786 G -> A LOC_Os11g48000.1 downstream_gene_variant ; 2513.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg1128944786 G -> A LOC_Os11g47990-LOC_Os11g48000 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1128944786 NA 1.17E-33 mr1026 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128944786 NA 3.14E-33 mr1161 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128944786 NA 1.50E-08 mr1260 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128944786 NA 4.57E-15 mr1870 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128944786 NA 5.30E-49 mr1063_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128944786 NA 3.30E-35 mr1161_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128944786 NA 1.79E-19 mr1180_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128944786 NA 1.40E-06 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128944786 NA 4.05E-21 mr1183_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128944786 NA 1.31E-17 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251