Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1128944786:

Variant ID: vg1128944786 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 28944786
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

ATGAACATGGTGGTGCTACAGTAAACATTTGCTAATGATGGATTAACTAGGCTTAATATATTCGTCTCACAGTTTATAGGCGAAATATGTAATTTATTTT[G/A]
TTATTAGTCTACATTTAATACTTCAAATGCGTGTCCGTATACGTCAAAAGTTTTTATTTTTTGCTAAAACAACTAAATACGGCCGGAGTAGCAATGTGCA

Reverse complement sequence

TGCACATTGCTACTCCGGCCGTATTTAGTTGTTTTAGCAAAAAATAAAAACTTTTGACGTATACGGACACGCATTTGAAGTATTAAATGTAGACTAATAA[C/T]
AAAATAAATTACATATTTCGCCTATAAACTGTGAGACGAATATATTAAGCCTAGTTAATCCATCATTAGCAAATGTTTACTGTAGCACCACCATGTTCAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.70%	42.30%	0.06%	0.00%	NA
All Indica	2759	31.80%	68.10%	0.07%	0.00%	NA
All Japonica	1512	95.80%	4.20%	0.07%	0.00%	NA
Aus	269	92.20%	7.80%	0.00%	0.00%	NA
Indica I	595	10.10%	89.70%	0.17%	0.00%	NA
Indica II	465	14.80%	85.20%	0.00%	0.00%	NA
Indica III	913	52.80%	47.10%	0.11%	0.00%	NA
Indica Intermediate	786	34.00%	66.00%	0.00%	0.00%	NA
Temperate Japonica	767	94.00%	5.90%	0.13%	0.00%	NA
Tropical Japonica	504	97.00%	3.00%	0.00%	0.00%	NA
Japonica Intermediate	241	98.80%	1.20%	0.00%	0.00%	NA
VI/Aromatic	96	95.80%	4.20%	0.00%	0.00%	NA
Intermediate	90	66.70%	33.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1128944786	G -> A	LOC_Os11g47980.1	upstream_gene_variant ; 4879.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg1128944786	G -> A	LOC_Os11g47990.1	upstream_gene_variant ; 3831.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg1128944786	G -> A	LOC_Os11g48000.1	downstream_gene_variant ; 2513.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg1128944786	G -> A	LOC_Os11g47990-LOC_Os11g48000	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1128944786	NA	1.17E-33	mr1026	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128944786	NA	3.14E-33	mr1161	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128944786	NA	1.50E-08	mr1260	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128944786	NA	4.57E-15	mr1870	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128944786	NA	5.30E-49	mr1063_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128944786	NA	3.30E-35	mr1161_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128944786	NA	1.79E-19	mr1180_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128944786	NA	1.40E-06	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128944786	NA	4.05E-21	mr1183_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128944786	NA	1.31E-17	mr1870_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251