Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128910848:

Variant ID: vg1128910848 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 28910848
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GACATGTACCAAACACTTTTGAGATTCCGAATAATATATAAGAGTTGCCGCTCCGCTCCTAAAAATTACACTAAAAAAGTGGAGTGGCATTTCTGCTACT[C/T]
CTCACCTCCACTCCACCCTAGAGTAGGAGCTCTATAAAATATACCCTTTACTATAAAGACAACATTACGATATGGCACTTATACTAAGAAATTATACCAT

Reverse complement sequence

ATGGTATAATTTCTTAGTATAAGTGCCATATCGTAATGTTGTCTTTATAGTAAAGGGTATATTTTATAGAGCTCCTACTCTAGGGTGGAGTGGAGGTGAG[G/A]
AGTAGCAGAAATGCCACTCCACTTTTTTAGTGTAATTTTTAGGAGCGGAGCGGCAACTCTTATATATTATTCGGAATCTCAAAAGTGTTTGGTACATGTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.00%	6.30%	0.04%	0.63%	NA
All Indica	2759	93.10%	6.80%	0.04%	0.00%	NA
All Japonica	1512	97.70%	0.30%	0.07%	1.98%	NA
Aus	269	62.10%	37.90%	0.00%	0.00%	NA
Indica I	595	96.60%	3.40%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	90.40%	9.50%	0.11%	0.00%	NA
Indica Intermediate	786	89.90%	10.10%	0.00%	0.00%	NA
Temperate Japonica	767	99.90%	0.00%	0.00%	0.13%	NA
Tropical Japonica	504	93.80%	0.40%	0.20%	5.56%	NA
Japonica Intermediate	241	98.80%	0.80%	0.00%	0.41%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1128910848	C -> T	LOC_Os11g47940.1	upstream_gene_variant ; 3063.0bp to feature; MODIFIER	silent_mutation	Average:53.376; most accessible tissue: Zhenshan97 flower, score: 69.437	N	N	N	N
vg1128910848	C -> T	LOC_Os11g47930-LOC_Os11g47940	intergenic_region ; MODIFIER	silent_mutation	Average:53.376; most accessible tissue: Zhenshan97 flower, score: 69.437	N	N	N	N
vg1128910848	C -> DEL	N	N	silent_mutation	Average:53.376; most accessible tissue: Zhenshan97 flower, score: 69.437	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1128910848	NA	3.27E-06	mr1054	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128910848	NA	1.03E-06	mr1286	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128910848	NA	2.92E-06	mr1287	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128910848	NA	1.81E-06	mr1331	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128910848	NA	5.36E-07	mr1365	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128910848	NA	2.19E-06	mr1372	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128910848	NA	9.87E-08	mr1420	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128910848	NA	8.27E-06	mr1424	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128910848	NA	4.11E-06	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128910848	NA	5.64E-09	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128910848	NA	5.76E-06	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128910848	NA	3.62E-06	mr1777	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128910848	NA	1.94E-06	mr1887	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251