\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128910848:

Variant ID: vg1128910848 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 28910848
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GACATGTACCAAACACTTTTGAGATTCCGAATAATATATAAGAGTTGCCGCTCCGCTCCTAAAAATTACACTAAAAAAGTGGAGTGGCATTTCTGCTACT[C/T]
CTCACCTCCACTCCACCCTAGAGTAGGAGCTCTATAAAATATACCCTTTACTATAAAGACAACATTACGATATGGCACTTATACTAAGAAATTATACCAT

Reverse complement sequence

ATGGTATAATTTCTTAGTATAAGTGCCATATCGTAATGTTGTCTTTATAGTAAAGGGTATATTTTATAGAGCTCCTACTCTAGGGTGGAGTGGAGGTGAG[G/A]
AGTAGCAGAAATGCCACTCCACTTTTTTAGTGTAATTTTTAGGAGCGGAGCGGCAACTCTTATATATTATTCGGAATCTCAAAAGTGTTTGGTACATGTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.00% 6.30% 0.04% 0.63% NA
All Indica  2759 93.10% 6.80% 0.04% 0.00% NA
All Japonica  1512 97.70% 0.30% 0.07% 1.98% NA
Aus  269 62.10% 37.90% 0.00% 0.00% NA
Indica I  595 96.60% 3.40% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 90.40% 9.50% 0.11% 0.00% NA
Indica Intermediate  786 89.90% 10.10% 0.00% 0.00% NA
Temperate Japonica  767 99.90% 0.00% 0.00% 0.13% NA
Tropical Japonica  504 93.80% 0.40% 0.20% 5.56% NA
Japonica Intermediate  241 98.80% 0.80% 0.00% 0.41% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1128910848 C -> T LOC_Os11g47940.1 upstream_gene_variant ; 3063.0bp to feature; MODIFIER silent_mutation Average:53.376; most accessible tissue: Zhenshan97 flower, score: 69.437 N N N N
vg1128910848 C -> T LOC_Os11g47930-LOC_Os11g47940 intergenic_region ; MODIFIER silent_mutation Average:53.376; most accessible tissue: Zhenshan97 flower, score: 69.437 N N N N
vg1128910848 C -> DEL N N silent_mutation Average:53.376; most accessible tissue: Zhenshan97 flower, score: 69.437 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1128910848 NA 3.27E-06 mr1054 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128910848 NA 1.03E-06 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128910848 NA 2.92E-06 mr1287 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128910848 NA 1.81E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128910848 NA 5.36E-07 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128910848 NA 2.19E-06 mr1372 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128910848 NA 9.87E-08 mr1420 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128910848 NA 8.27E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128910848 NA 4.11E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128910848 NA 5.64E-09 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128910848 NA 5.76E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128910848 NA 3.62E-06 mr1777 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128910848 NA 1.94E-06 mr1887 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251