Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128853223:

Variant ID: vg1128853223 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 28853223
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGATCCTAACAAATATGAAATTAGCATCACATGAAAGTACTTCAAAATATGAATCTAGTGATATAACATGCATAATACTTAATATAGATATAGTTAATAT[A/G]
ATTATTAGTTAAAAACTTCCGAGTTTAATTTTACTTAAAAAGGAGCGCCCTATAATTTGGGACGAAGGGAGTACTTCTCATCTATACTCCTCTCTGTGTT

Reverse complement sequence

AACACAGAGAGGAGTATAGATGAGAAGTACTCCCTTCGTCCCAAATTATAGGGCGCTCCTTTTTAAGTAAAATTAAACTCGGAAGTTTTTAACTAATAAT[T/C]
ATATTAACTATATCTATATTAAGTATTATGCATGTTATATCACTAGATTCATATTTTGAAGTACTTTCATGTGATGCTAATTTCATATTTGTTAGGATCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.40% 22.40% 0.13% 0.00% NA
All Indica  2759 79.00% 20.90% 0.04% 0.00% NA
All Japonica  1512 85.80% 14.00% 0.13% 0.00% NA
Aus  269 30.90% 68.80% 0.37% 0.00% NA
Indica I  595 89.90% 10.10% 0.00% 0.00% NA
Indica II  465 97.20% 2.60% 0.22% 0.00% NA
Indica III  913 61.70% 38.30% 0.00% 0.00% NA
Indica Intermediate  786 80.20% 19.80% 0.00% 0.00% NA
Temperate Japonica  767 87.90% 12.00% 0.13% 0.00% NA
Tropical Japonica  504 84.90% 15.10% 0.00% 0.00% NA
Japonica Intermediate  241 81.30% 18.30% 0.41% 0.00% NA
VI/Aromatic  96 28.10% 69.80% 2.08% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1128853223 A -> G LOC_Os11g47830.1 upstream_gene_variant ; 285.0bp to feature; MODIFIER silent_mutation Average:77.003; most accessible tissue: Callus, score: 95.927 N N N N
vg1128853223 A -> G LOC_Os11g47830.2 upstream_gene_variant ; 285.0bp to feature; MODIFIER silent_mutation Average:77.003; most accessible tissue: Callus, score: 95.927 N N N N
vg1128853223 A -> G LOC_Os11g47840.1 downstream_gene_variant ; 284.0bp to feature; MODIFIER silent_mutation Average:77.003; most accessible tissue: Callus, score: 95.927 N N N N
vg1128853223 A -> G LOC_Os11g47830-LOC_Os11g47840 intergenic_region ; MODIFIER silent_mutation Average:77.003; most accessible tissue: Callus, score: 95.927 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1128853223 A G -0.04 -0.04 -0.04 -0.02 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1128853223 NA 3.57E-06 mr1522_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128853223 NA 3.23E-06 mr1817_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128853223 4.13E-06 NA mr1933_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251