Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128846586:

Variant ID: vg1128846586 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 28846586
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


GGATGTCCCCTCGTATACTTTTTCTTTCAAATTTAATGCAAATAGCCGTGAAAAATTCTTAAAATAATTGATAACGCATAGTGATATCTACCAGTCCACC[G/A]
AAAATCAAGTTCAAATTCGACCTACACATTGAGAAAAAAAAAGACAAATTTAGATATGAACAGTACACTACTATTCATACGCTTAATTTATATTTTTTTT

Reverse complement sequence

AAAAAAAATATAAATTAAGCGTATGAATAGTAGTGTACTGTTCATATCTAAATTTGTCTTTTTTTTTCTCAATGTGTAGGTCGAATTTGAACTTGATTTT[C/T]
GGTGGACTGGTAGATATCACTATGCGTTATCAATTATTTTAAGAATTTTTCACGGCTATTTGCATTAAATTTGAAAGAAAAAGTATACGAGGGGACATCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.60% 24.20% 0.15% 0.00% NA
All Indica  2759 97.60% 2.20% 0.14% 0.00% NA
All Japonica  1512 31.10% 68.80% 0.13% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 95.90% 3.70% 0.43% 0.00% NA
Indica III  913 99.60% 0.40% 0.00% 0.00% NA
Indica Intermediate  786 95.50% 4.20% 0.25% 0.00% NA
Temperate Japonica  767 49.70% 50.20% 0.13% 0.00% NA
Tropical Japonica  504 10.10% 89.90% 0.00% 0.00% NA
Japonica Intermediate  241 15.80% 83.80% 0.41% 0.00% NA
VI/Aromatic  96 77.10% 22.90% 0.00% 0.00% NA
Intermediate  90 75.60% 23.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1128846586 G -> A LOC_Os11g47820.1 upstream_gene_variant ; 3777.0bp to feature; MODIFIER silent_mutation Average:70.045; most accessible tissue: Zhenshan97 panicle, score: 86.788 N N N N
vg1128846586 G -> A LOC_Os11g47820.2 upstream_gene_variant ; 3777.0bp to feature; MODIFIER silent_mutation Average:70.045; most accessible tissue: Zhenshan97 panicle, score: 86.788 N N N N
vg1128846586 G -> A LOC_Os11g47830.2 downstream_gene_variant ; 459.0bp to feature; MODIFIER silent_mutation Average:70.045; most accessible tissue: Zhenshan97 panicle, score: 86.788 N N N N
vg1128846586 G -> A LOC_Os11g47830.1 intron_variant ; MODIFIER silent_mutation Average:70.045; most accessible tissue: Zhenshan97 panicle, score: 86.788 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1128846586 G A -0.02 -0.01 -0.02 -0.01 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1128846586 NA 5.48E-11 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1128846586 NA 1.26E-13 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128846586 NA 1.78E-07 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128846586 2.28E-07 NA mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128846586 9.81E-06 2.36E-10 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128846586 NA 5.50E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128846586 NA 2.75E-14 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128846586 4.29E-08 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128846586 NA 4.24E-10 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128846586 1.47E-09 NA mr1310_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128846586 3.89E-07 1.32E-13 mr1310_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128846586 NA 2.54E-19 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128846586 NA 1.53E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128846586 3.04E-06 NA mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128846586 4.47E-07 2.26E-11 mr1959_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251