\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128844615:

Variant ID: vg1128844615 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 28844615
Reference Allele: CAlternative Allele: T,CAAG
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGGGGCTAAATTTTTTTTAGATGGACTAAAACAAGTCACTCCCATCAAAACACCACCCTAGTGTTATACTCCCTCCATTCTAAATTGATCTACATATTT[C/T,CAAG]
ATAGGTACACTAAAACCAATAAAAGCTAATAACTCTCTCATACTATATTTACTCTAGCAACAAACTCGATGCATGCACCACCTCCAATATTTCCTAGCCA

Reverse complement sequence

TGGCTAGGAAATATTGGAGGTGGTGCATGCATCGAGTTTGTTGCTAGAGTAAATATAGTATGAGAGAGTTATTAGCTTTTATTGGTTTTAGTGTACCTAT[G/A,CTTG]
AAATATGTAGATCAATTTAGAATGGAGGGAGTATAACACTAGGGTGGTGTTTTGATGGGAGTGACTTGTTTTAGTCCATCTAAAAAAAATTTAGCCCCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.60% 21.30% 3.36% 2.69% CAAG: 0.04%
All Indica  2759 94.30% 4.60% 0.76% 0.33% NA
All Japonica  1512 30.80% 55.00% 6.28% 7.80% CAAG: 0.13%
Aus  269 84.80% 0.70% 14.50% 0.00% NA
Indica I  595 99.00% 0.70% 0.34% 0.00% NA
Indica II  465 95.90% 2.40% 1.08% 0.65% NA
Indica III  913 90.10% 9.60% 0.11% 0.11% NA
Indica Intermediate  786 94.70% 3.10% 1.65% 0.64% NA
Temperate Japonica  767 52.20% 27.60% 7.43% 12.52% CAAG: 0.26%
Tropical Japonica  504 5.60% 87.90% 4.56% 1.98% NA
Japonica Intermediate  241 15.40% 73.40% 6.22% 4.98% NA
VI/Aromatic  96 77.10% 22.90% 0.00% 0.00% NA
Intermediate  90 71.10% 24.40% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1128844615 C -> T LOC_Os11g47820.1 upstream_gene_variant ; 1806.0bp to feature; MODIFIER silent_mutation Average:78.677; most accessible tissue: Minghui63 panicle, score: 93.735 N N N N
vg1128844615 C -> T LOC_Os11g47820.2 upstream_gene_variant ; 1806.0bp to feature; MODIFIER silent_mutation Average:78.677; most accessible tissue: Minghui63 panicle, score: 93.735 N N N N
vg1128844615 C -> T LOC_Os11g47830.1 downstream_gene_variant ; 1290.0bp to feature; MODIFIER silent_mutation Average:78.677; most accessible tissue: Minghui63 panicle, score: 93.735 N N N N
vg1128844615 C -> T LOC_Os11g47830.2 downstream_gene_variant ; 2430.0bp to feature; MODIFIER silent_mutation Average:78.677; most accessible tissue: Minghui63 panicle, score: 93.735 N N N N
vg1128844615 C -> T LOC_Os11g47820-LOC_Os11g47830 intergenic_region ; MODIFIER silent_mutation Average:78.677; most accessible tissue: Minghui63 panicle, score: 93.735 N N N N
vg1128844615 C -> CAAG LOC_Os11g47820.1 upstream_gene_variant ; 1807.0bp to feature; MODIFIER silent_mutation Average:78.677; most accessible tissue: Minghui63 panicle, score: 93.735 N N N N
vg1128844615 C -> CAAG LOC_Os11g47820.2 upstream_gene_variant ; 1807.0bp to feature; MODIFIER silent_mutation Average:78.677; most accessible tissue: Minghui63 panicle, score: 93.735 N N N N
vg1128844615 C -> CAAG LOC_Os11g47830.1 downstream_gene_variant ; 1289.0bp to feature; MODIFIER silent_mutation Average:78.677; most accessible tissue: Minghui63 panicle, score: 93.735 N N N N
vg1128844615 C -> CAAG LOC_Os11g47830.2 downstream_gene_variant ; 2429.0bp to feature; MODIFIER silent_mutation Average:78.677; most accessible tissue: Minghui63 panicle, score: 93.735 N N N N
vg1128844615 C -> CAAG LOC_Os11g47820-LOC_Os11g47830 intergenic_region ; MODIFIER silent_mutation Average:78.677; most accessible tissue: Minghui63 panicle, score: 93.735 N N N N
vg1128844615 C -> DEL N N silent_mutation Average:78.677; most accessible tissue: Minghui63 panicle, score: 93.735 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1128844615 C CAAG -0.44 -0.23 -0.33 -0.42 -0.39 -0.3
vg1128844615 C T 0.02 0.0 0.0 -0.01 -0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1128844615 NA 1.08E-10 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1128844615 NA 3.09E-14 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128844615 NA 4.96E-26 mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128844615 5.16E-06 NA mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128844615 NA 7.86E-09 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128844615 1.01E-06 NA mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128844615 NA 7.80E-11 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128844615 NA 8.28E-07 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128844615 NA 1.82E-12 mr1626 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128844615 NA 6.87E-09 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128844615 NA 1.55E-16 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128844615 1.36E-06 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128844615 NA 3.97E-10 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128844615 NA 1.82E-06 mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128844615 2.61E-08 NA mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128844615 3.31E-06 1.32E-13 mr1310_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128844615 NA 3.55E-21 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128844615 NA 2.50E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128844615 4.55E-06 NA mr1959_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128844615 8.47E-06 2.26E-10 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251