\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128842480:

Variant ID: vg1128842480 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 28842480
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTTGGGGAGGGAGACGGCGAGGGAGATGGGTGTGTTGGCGAAGGCGGAGATGAAGGCCGGGTTGGCGTCGAACAGCTTCACGCGGTCGATGGTGGTGTG[C/A]
GCGGCGAGGAAGGCCGCCACGTCCTTGGGCGGAGGGAGGTTGTCGGCGTTGGCGCCGTAGTTGACGCCCACCGCCATCGACGGGAGCGCCGCCTCGGCCG

Reverse complement sequence

CGGCCGAGGCGGCGCTCCCGTCGATGGCGGTGGGCGTCAACTACGGCGCCAACGCCGACAACCTCCCTCCGCCCAAGGACGTGGCGGCCTTCCTCGCCGC[G/T]
CACACCACCATCGACCGCGTGAAGCTGTTCGACGCCAACCCGGCCTTCATCTCCGCCTTCGCCAACACACCCATCTCCCTCGCCGTCTCCCTCCCCAACT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.40% 25.00% 0.63% 0.04% NA
All Indica  2759 97.40% 2.50% 0.14% 0.00% NA
All Japonica  1512 29.80% 68.60% 1.52% 0.13% NA
Aus  269 88.80% 10.40% 0.74% 0.00% NA
Indica I  595 99.00% 1.00% 0.00% 0.00% NA
Indica II  465 96.30% 3.20% 0.43% 0.00% NA
Indica III  913 99.10% 0.90% 0.00% 0.00% NA
Indica Intermediate  786 94.70% 5.10% 0.25% 0.00% NA
Temperate Japonica  767 47.60% 49.80% 2.48% 0.13% NA
Tropical Japonica  504 9.30% 89.90% 0.60% 0.20% NA
Japonica Intermediate  241 15.80% 83.80% 0.41% 0.00% NA
VI/Aromatic  96 74.00% 26.00% 0.00% 0.00% NA
Intermediate  90 75.60% 23.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1128842480 C -> A LOC_Os11g47820.1 synonymous_variant ; p.Ala59Ala; LOW synonymous_codon Average:96.566; most accessible tissue: Zhenshan97 flag leaf, score: 98.544 N N N N
vg1128842480 C -> A LOC_Os11g47820.2 synonymous_variant ; p.Ala59Ala; LOW synonymous_codon Average:96.566; most accessible tissue: Zhenshan97 flag leaf, score: 98.544 N N N N
vg1128842480 C -> DEL LOC_Os11g47820.2 N frameshift_variant Average:96.566; most accessible tissue: Zhenshan97 flag leaf, score: 98.544 N N N N
vg1128842480 C -> DEL LOC_Os11g47820.1 N frameshift_variant Average:96.566; most accessible tissue: Zhenshan97 flag leaf, score: 98.544 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1128842480 C A -0.02 -0.02 -0.03 0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1128842480 NA 4.01E-10 Grain_weight All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1128842480 NA 5.23E-13 mr1035 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128842480 NA 3.29E-26 mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128842480 2.25E-06 NA mr1300 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128842480 NA 1.30E-08 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128842480 1.40E-07 NA mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128842480 2.15E-06 6.06E-11 mr1310 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128842480 NA 4.23E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128842480 NA 2.61E-16 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128842480 8.22E-08 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128842480 2.75E-06 4.25E-11 mr1926 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128842480 NA 3.90E-06 mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128842480 4.19E-06 NA mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128842480 5.15E-06 2.47E-11 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128842480 NA 2.35E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128842480 NA 3.87E-08 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128842480 NA 1.50E-09 mr1851_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128842480 NA 1.25E-08 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251