Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128817982:

Variant ID: vg1128817982 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 28817982
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTTAGCTTGATGCTTCTGCTTCGATCTTTAATTGTTGGCTTTTATTTTCTTTTTTTTTATGCGAGATTGTGAGGCAAGGAAGGGATTGTTGAGGGATCTT[C/T]
ATCATTATTTTCTTCATTTGTTTTCCTCTTGCCTCTTCTTTTCCTACCCAATGGGCATTTAGCTCTGCATGCTAGTTTACACATCCTCCCTCAGGTATCA

Reverse complement sequence

TGATACCTGAGGGAGGATGTGTAAACTAGCATGCAGAGCTAAATGCCCATTGGGTAGGAAAAGAAGAGGCAAGAGGAAAACAAATGAAGAAAATAATGAT[G/A]
AAGATCCCTCAACAATCCCTTCCTTGCCTCACAATCTCGCATAAAAAAAAAGAAAATAAAAGCCAACAATTAAAGATCGAAGCAGAAGCATCAAGCTAAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	64.90%	10.20%	7.51%	17.39%	NA
All Indica	2759	84.40%	5.10%	5.47%	5.04%	NA
All Japonica	1512	31.30%	18.20%	8.99%	41.53%	NA
Aus	269	69.90%	11.90%	11.52%	6.69%	NA
Indica I	595	94.50%	2.70%	1.18%	1.68%	NA
Indica II	465	95.50%	1.30%	1.29%	1.94%	NA
Indica III	913	71.40%	9.60%	9.64%	9.31%	NA
Indica Intermediate	786	85.40%	3.80%	6.36%	4.45%	NA
Temperate Japonica	767	52.00%	8.50%	7.43%	32.07%	NA
Tropical Japonica	504	9.50%	27.80%	12.30%	50.40%	NA
Japonica Intermediate	241	10.80%	29.00%	7.05%	53.11%	NA
VI/Aromatic	96	13.50%	28.10%	35.42%	22.92%	NA
Intermediate	90	71.10%	8.90%	3.33%	16.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1128817982	C -> T	LOC_Os11g47780.1	upstream_gene_variant ; 2259.0bp to feature; MODIFIER	silent_mutation	Average:47.587; most accessible tissue: Callus, score: 84.197	N	N	N	N
vg1128817982	C -> T	LOC_Os11g47790.1	upstream_gene_variant ; 481.0bp to feature; MODIFIER	silent_mutation	Average:47.587; most accessible tissue: Callus, score: 84.197	N	N	N	N
vg1128817982	C -> T	LOC_Os11g47800.1	upstream_gene_variant ; 2783.0bp to feature; MODIFIER	silent_mutation	Average:47.587; most accessible tissue: Callus, score: 84.197	N	N	N	N
vg1128817982	C -> T	LOC_Os11g47780-LOC_Os11g47790	intergenic_region ; MODIFIER	silent_mutation	Average:47.587; most accessible tissue: Callus, score: 84.197	N	N	N	N
vg1128817982	C -> DEL	N	N	silent_mutation	Average:47.587; most accessible tissue: Callus, score: 84.197	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1128817982	8.26E-07	NA	mr1238	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817982	5.92E-06	1.26E-06	mr1238	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817982	NA	6.87E-07	mr1300	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817982	NA	4.25E-08	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817982	7.39E-06	7.39E-06	mr1609	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817982	NA	1.21E-14	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817982	2.83E-06	9.31E-08	mr1900	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817982	5.53E-06	NA	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817982	NA	7.32E-08	mr1926	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817982	NA	6.28E-06	mr1959	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817982	NA	1.23E-09	mr1310_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817982	3.49E-06	3.49E-06	mr1609_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817982	NA	6.38E-08	mr1959_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251