\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128817982:

Variant ID: vg1128817982 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 28817982
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTTAGCTTGATGCTTCTGCTTCGATCTTTAATTGTTGGCTTTTATTTTCTTTTTTTTTATGCGAGATTGTGAGGCAAGGAAGGGATTGTTGAGGGATCTT[C/T]
ATCATTATTTTCTTCATTTGTTTTCCTCTTGCCTCTTCTTTTCCTACCCAATGGGCATTTAGCTCTGCATGCTAGTTTACACATCCTCCCTCAGGTATCA

Reverse complement sequence

TGATACCTGAGGGAGGATGTGTAAACTAGCATGCAGAGCTAAATGCCCATTGGGTAGGAAAAGAAGAGGCAAGAGGAAAACAAATGAAGAAAATAATGAT[G/A]
AAGATCCCTCAACAATCCCTTCCTTGCCTCACAATCTCGCATAAAAAAAAAGAAAATAAAAGCCAACAATTAAAGATCGAAGCAGAAGCATCAAGCTAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.90% 10.20% 7.51% 17.39% NA
All Indica  2759 84.40% 5.10% 5.47% 5.04% NA
All Japonica  1512 31.30% 18.20% 8.99% 41.53% NA
Aus  269 69.90% 11.90% 11.52% 6.69% NA
Indica I  595 94.50% 2.70% 1.18% 1.68% NA
Indica II  465 95.50% 1.30% 1.29% 1.94% NA
Indica III  913 71.40% 9.60% 9.64% 9.31% NA
Indica Intermediate  786 85.40% 3.80% 6.36% 4.45% NA
Temperate Japonica  767 52.00% 8.50% 7.43% 32.07% NA
Tropical Japonica  504 9.50% 27.80% 12.30% 50.40% NA
Japonica Intermediate  241 10.80% 29.00% 7.05% 53.11% NA
VI/Aromatic  96 13.50% 28.10% 35.42% 22.92% NA
Intermediate  90 71.10% 8.90% 3.33% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1128817982 C -> T LOC_Os11g47780.1 upstream_gene_variant ; 2259.0bp to feature; MODIFIER silent_mutation Average:47.587; most accessible tissue: Callus, score: 84.197 N N N N
vg1128817982 C -> T LOC_Os11g47790.1 upstream_gene_variant ; 481.0bp to feature; MODIFIER silent_mutation Average:47.587; most accessible tissue: Callus, score: 84.197 N N N N
vg1128817982 C -> T LOC_Os11g47800.1 upstream_gene_variant ; 2783.0bp to feature; MODIFIER silent_mutation Average:47.587; most accessible tissue: Callus, score: 84.197 N N N N
vg1128817982 C -> T LOC_Os11g47780-LOC_Os11g47790 intergenic_region ; MODIFIER silent_mutation Average:47.587; most accessible tissue: Callus, score: 84.197 N N N N
vg1128817982 C -> DEL N N silent_mutation Average:47.587; most accessible tissue: Callus, score: 84.197 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1128817982 8.26E-07 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817982 5.92E-06 1.26E-06 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817982 NA 6.87E-07 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817982 NA 4.25E-08 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817982 7.39E-06 7.39E-06 mr1609 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817982 NA 1.21E-14 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817982 2.83E-06 9.31E-08 mr1900 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817982 5.53E-06 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817982 NA 7.32E-08 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817982 NA 6.28E-06 mr1959 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817982 NA 1.23E-09 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817982 3.49E-06 3.49E-06 mr1609_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817982 NA 6.38E-08 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251