\
| Variant ID: vg1128817982 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 28817982 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTTAGCTTGATGCTTCTGCTTCGATCTTTAATTGTTGGCTTTTATTTTCTTTTTTTTTATGCGAGATTGTGAGGCAAGGAAGGGATTGTTGAGGGATCTT[C/T]
ATCATTATTTTCTTCATTTGTTTTCCTCTTGCCTCTTCTTTTCCTACCCAATGGGCATTTAGCTCTGCATGCTAGTTTACACATCCTCCCTCAGGTATCA
TGATACCTGAGGGAGGATGTGTAAACTAGCATGCAGAGCTAAATGCCCATTGGGTAGGAAAAGAAGAGGCAAGAGGAAAACAAATGAAGAAAATAATGAT[G/A]
AAGATCCCTCAACAATCCCTTCCTTGCCTCACAATCTCGCATAAAAAAAAAGAAAATAAAAGCCAACAATTAAAGATCGAAGCAGAAGCATCAAGCTAAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.90% | 10.20% | 7.51% | 17.39% | NA |
| All Indica | 2759 | 84.40% | 5.10% | 5.47% | 5.04% | NA |
| All Japonica | 1512 | 31.30% | 18.20% | 8.99% | 41.53% | NA |
| Aus | 269 | 69.90% | 11.90% | 11.52% | 6.69% | NA |
| Indica I | 595 | 94.50% | 2.70% | 1.18% | 1.68% | NA |
| Indica II | 465 | 95.50% | 1.30% | 1.29% | 1.94% | NA |
| Indica III | 913 | 71.40% | 9.60% | 9.64% | 9.31% | NA |
| Indica Intermediate | 786 | 85.40% | 3.80% | 6.36% | 4.45% | NA |
| Temperate Japonica | 767 | 52.00% | 8.50% | 7.43% | 32.07% | NA |
| Tropical Japonica | 504 | 9.50% | 27.80% | 12.30% | 50.40% | NA |
| Japonica Intermediate | 241 | 10.80% | 29.00% | 7.05% | 53.11% | NA |
| VI/Aromatic | 96 | 13.50% | 28.10% | 35.42% | 22.92% | NA |
| Intermediate | 90 | 71.10% | 8.90% | 3.33% | 16.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1128817982 | C -> T | LOC_Os11g47780.1 | upstream_gene_variant ; 2259.0bp to feature; MODIFIER | silent_mutation | Average:47.587; most accessible tissue: Callus, score: 84.197 | N | N | N | N |
| vg1128817982 | C -> T | LOC_Os11g47790.1 | upstream_gene_variant ; 481.0bp to feature; MODIFIER | silent_mutation | Average:47.587; most accessible tissue: Callus, score: 84.197 | N | N | N | N |
| vg1128817982 | C -> T | LOC_Os11g47800.1 | upstream_gene_variant ; 2783.0bp to feature; MODIFIER | silent_mutation | Average:47.587; most accessible tissue: Callus, score: 84.197 | N | N | N | N |
| vg1128817982 | C -> T | LOC_Os11g47780-LOC_Os11g47790 | intergenic_region ; MODIFIER | silent_mutation | Average:47.587; most accessible tissue: Callus, score: 84.197 | N | N | N | N |
| vg1128817982 | C -> DEL | N | N | silent_mutation | Average:47.587; most accessible tissue: Callus, score: 84.197 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1128817982 | 8.26E-07 | NA | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128817982 | 5.92E-06 | 1.26E-06 | mr1238 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128817982 | NA | 6.87E-07 | mr1300 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128817982 | NA | 4.25E-08 | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128817982 | 7.39E-06 | 7.39E-06 | mr1609 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128817982 | NA | 1.21E-14 | mr1900 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128817982 | 2.83E-06 | 9.31E-08 | mr1900 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128817982 | 5.53E-06 | NA | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128817982 | NA | 7.32E-08 | mr1926 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128817982 | NA | 6.28E-06 | mr1959 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128817982 | NA | 1.23E-09 | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128817982 | 3.49E-06 | 3.49E-06 | mr1609_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128817982 | NA | 6.38E-08 | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |