\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128817881:

Variant ID: vg1128817881 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 28817881
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTGGATTTAGAGCAATCAATGGCTCTAATATATCACAAGCACTGTAGAAAGTCTATTTTTTTAAAACAAAGTTTATCCTTGCCTTGCTCTTCATCCTGC[A/G]
CTTAGCTTGATGCTTCTGCTTCGATCTTTAATTGTTGGCTTTTATTTTCTTTTTTTTTATGCGAGATTGTGAGGCAAGGAAGGGATTGTTGAGGGATCTT

Reverse complement sequence

AAGATCCCTCAACAATCCCTTCCTTGCCTCACAATCTCGCATAAAAAAAAAGAAAATAAAAGCCAACAATTAAAGATCGAAGCAGAAGCATCAAGCTAAG[T/C]
GCAGGATGAAGAGCAAGGCAAGGATAAACTTTGTTTTAAAAAAATAGACTTTCTACAGTGCTTGTGATATATTAGAGCCATTGATTGCTCTAAATCCAAC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.90% 2.50% 2.24% 30.45% NA
All Indica  2759 84.40% 2.70% 2.79% 10.11% NA
All Japonica  1512 31.40% 1.30% 0.26% 67.06% NA
Aus  269 69.10% 7.40% 3.35% 20.07% NA
Indica I  595 94.30% 2.50% 0.00% 3.19% NA
Indica II  465 95.50% 0.90% 0.22% 3.44% NA
Indica III  913 71.50% 4.80% 7.34% 16.32% NA
Indica Intermediate  786 85.20% 1.50% 1.15% 12.09% NA
Temperate Japonica  767 52.00% 0.00% 0.13% 47.85% NA
Tropical Japonica  504 9.90% 1.00% 0.60% 88.49% NA
Japonica Intermediate  241 10.80% 5.80% 0.00% 83.40% NA
VI/Aromatic  96 12.50% 1.00% 14.58% 71.88% NA
Intermediate  90 71.10% 1.10% 2.22% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1128817881 A -> DEL N N silent_mutation Average:44.605; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg1128817881 A -> G LOC_Os11g47780.1 upstream_gene_variant ; 2158.0bp to feature; MODIFIER silent_mutation Average:44.605; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg1128817881 A -> G LOC_Os11g47790.1 upstream_gene_variant ; 582.0bp to feature; MODIFIER silent_mutation Average:44.605; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg1128817881 A -> G LOC_Os11g47800.1 upstream_gene_variant ; 2884.0bp to feature; MODIFIER silent_mutation Average:44.605; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N
vg1128817881 A -> G LOC_Os11g47780-LOC_Os11g47790 intergenic_region ; MODIFIER silent_mutation Average:44.605; most accessible tissue: Minghui63 panicle, score: 56.842 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1128817881 2.34E-07 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817881 1.45E-06 5.38E-07 mr1238 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817881 NA 5.38E-07 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817881 4.39E-06 NA mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817881 NA 1.49E-08 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817881 NA 7.89E-14 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817881 5.37E-06 2.09E-07 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817881 9.05E-06 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817881 NA 1.09E-07 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817881 NA 1.23E-09 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817881 6.57E-06 6.57E-06 mr1609_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128817881 NA 9.78E-08 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251