\
| Variant ID: vg1128817881 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 28817881 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
GTTGGATTTAGAGCAATCAATGGCTCTAATATATCACAAGCACTGTAGAAAGTCTATTTTTTTAAAACAAAGTTTATCCTTGCCTTGCTCTTCATCCTGC[A/G]
CTTAGCTTGATGCTTCTGCTTCGATCTTTAATTGTTGGCTTTTATTTTCTTTTTTTTTATGCGAGATTGTGAGGCAAGGAAGGGATTGTTGAGGGATCTT
AAGATCCCTCAACAATCCCTTCCTTGCCTCACAATCTCGCATAAAAAAAAAGAAAATAAAAGCCAACAATTAAAGATCGAAGCAGAAGCATCAAGCTAAG[T/C]
GCAGGATGAAGAGCAAGGCAAGGATAAACTTTGTTTTAAAAAAATAGACTTTCTACAGTGCTTGTGATATATTAGAGCCATTGATTGCTCTAAATCCAAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.90% | 2.50% | 2.24% | 30.45% | NA |
| All Indica | 2759 | 84.40% | 2.70% | 2.79% | 10.11% | NA |
| All Japonica | 1512 | 31.40% | 1.30% | 0.26% | 67.06% | NA |
| Aus | 269 | 69.10% | 7.40% | 3.35% | 20.07% | NA |
| Indica I | 595 | 94.30% | 2.50% | 0.00% | 3.19% | NA |
| Indica II | 465 | 95.50% | 0.90% | 0.22% | 3.44% | NA |
| Indica III | 913 | 71.50% | 4.80% | 7.34% | 16.32% | NA |
| Indica Intermediate | 786 | 85.20% | 1.50% | 1.15% | 12.09% | NA |
| Temperate Japonica | 767 | 52.00% | 0.00% | 0.13% | 47.85% | NA |
| Tropical Japonica | 504 | 9.90% | 1.00% | 0.60% | 88.49% | NA |
| Japonica Intermediate | 241 | 10.80% | 5.80% | 0.00% | 83.40% | NA |
| VI/Aromatic | 96 | 12.50% | 1.00% | 14.58% | 71.88% | NA |
| Intermediate | 90 | 71.10% | 1.10% | 2.22% | 25.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1128817881 | A -> DEL | N | N | silent_mutation | Average:44.605; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg1128817881 | A -> G | LOC_Os11g47780.1 | upstream_gene_variant ; 2158.0bp to feature; MODIFIER | silent_mutation | Average:44.605; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg1128817881 | A -> G | LOC_Os11g47790.1 | upstream_gene_variant ; 582.0bp to feature; MODIFIER | silent_mutation | Average:44.605; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg1128817881 | A -> G | LOC_Os11g47800.1 | upstream_gene_variant ; 2884.0bp to feature; MODIFIER | silent_mutation | Average:44.605; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| vg1128817881 | A -> G | LOC_Os11g47780-LOC_Os11g47790 | intergenic_region ; MODIFIER | silent_mutation | Average:44.605; most accessible tissue: Minghui63 panicle, score: 56.842 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1128817881 | 2.34E-07 | NA | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128817881 | 1.45E-06 | 5.38E-07 | mr1238 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128817881 | NA | 5.38E-07 | mr1300 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128817881 | 4.39E-06 | NA | mr1310 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128817881 | NA | 1.49E-08 | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128817881 | NA | 7.89E-14 | mr1900 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128817881 | 5.37E-06 | 2.09E-07 | mr1900 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128817881 | 9.05E-06 | NA | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128817881 | NA | 1.09E-07 | mr1926 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128817881 | NA | 1.23E-09 | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128817881 | 6.57E-06 | 6.57E-06 | mr1609_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128817881 | NA | 9.78E-08 | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |