| Variant ID: vg1128816376 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 28816376 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ACCGGGCAAATGCATATCTTTGAACCATGGAAATCTTCATACACATCAATATTGTCGAATCACCTATCCCGTTGGATTAACAAACTACTACTCATCATGT[C/T]
AGATTCAACGGCTTACTGATCCACGCAGTAGCTTATTAGCGCATATATATATATATATATATATATATATATATATATATATATGCAAGCACACCGTACT
AGTACGGTGTGCTTGCATATATATATATATATATATATATATATATATATATATATATGCGCTAATAAGCTACTGCGTGGATCAGTAAGCCGTTGAATCT[G/A]
ACATGATGAGTAGTAGTTTGTTAATCCAACGGGATAGGTGATTCGACAATATTGATGTGTATGAAGATTTCCATGGTTCAAAGATATGCATTTGCCCGGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 65.50% | 0.10% | 1.21% | 33.16% | NA |
| All Indica | 2759 | 85.20% | 0.00% | 1.27% | 13.56% | NA |
| All Japonica | 1512 | 30.60% | 0.30% | 0.93% | 68.19% | NA |
| Aus | 269 | 74.70% | 0.40% | 2.23% | 22.68% | NA |
| Indica I | 595 | 94.60% | 0.00% | 0.00% | 5.38% | NA |
| Indica II | 465 | 96.10% | 0.00% | 0.22% | 3.66% | NA |
| Indica III | 913 | 72.60% | 0.00% | 2.74% | 24.64% | NA |
| Indica Intermediate | 786 | 86.10% | 0.00% | 1.15% | 12.72% | NA |
| Temperate Japonica | 767 | 50.60% | 0.50% | 1.43% | 47.46% | NA |
| Tropical Japonica | 504 | 9.70% | 0.00% | 0.20% | 90.08% | NA |
| Japonica Intermediate | 241 | 10.80% | 0.00% | 0.83% | 88.38% | NA |
| VI/Aromatic | 96 | 17.70% | 0.00% | 2.08% | 80.21% | NA |
| Intermediate | 90 | 73.30% | 0.00% | 0.00% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1128816376 | C -> T | LOC_Os11g47780.1 | upstream_gene_variant ; 653.0bp to feature; MODIFIER | silent_mutation | Average:52.062; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| vg1128816376 | C -> T | LOC_Os11g47790.1 | upstream_gene_variant ; 2087.0bp to feature; MODIFIER | silent_mutation | Average:52.062; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| vg1128816376 | C -> T | LOC_Os11g47800.1 | upstream_gene_variant ; 4389.0bp to feature; MODIFIER | silent_mutation | Average:52.062; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| vg1128816376 | C -> T | LOC_Os11g47770.1 | downstream_gene_variant ; 4826.0bp to feature; MODIFIER | silent_mutation | Average:52.062; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| vg1128816376 | C -> T | LOC_Os11g47780-LOC_Os11g47790 | intergenic_region ; MODIFIER | silent_mutation | Average:52.062; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| vg1128816376 | C -> DEL | N | N | silent_mutation | Average:52.062; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1128816376 | NA | 1.14E-08 | mr1300 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128816376 | 1.14E-06 | NA | mr1310 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128816376 | NA | 1.41E-10 | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128816376 | NA | 2.07E-14 | mr1900 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128816376 | NA | 1.64E-06 | mr1900 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128816376 | 3.12E-07 | NA | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128816376 | NA | 2.55E-10 | mr1926 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128816376 | 3.16E-06 | 6.52E-08 | mr1959 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128816376 | 1.92E-06 | NA | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128816376 | NA | 4.25E-12 | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128816376 | 8.39E-06 | 8.39E-06 | mr1609_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128816376 | 7.50E-06 | 3.08E-10 | mr1959_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |