\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128801321:

Variant ID: vg1128801321 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 28801321
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, A: 0.03, others allele: 0.00, population size: 204. )

Flanking Sequence (100 bp) in Reference Genome:


CTCACTCCATCAGCTGCTAGCTTTGCTAGCTAGGAGTAGCTAGCTGCTTGTGCTCTTGCTGTCGAGAGGAGGAAGAAAGACTCGAGGTGGTTGGCTGTCG[T/A]
GTTGTGCATGGCTGCATTCAGAGCCCCGACGGTGATGTCATCGACAGCGTGCCGCTGCACCTGCAACCGGCGTTCGACCACCCGAAGCTCATTCATTTTT

Reverse complement sequence

AAAAATGAATGAGCTTCGGGTGGTCGAACGCCGGTTGCAGGTGCAGCGGCACGCTGTCGATGACATCACCGTCGGGGCTCTGAATGCAGCCATGCACAAC[A/T]
CGACAGCCAACCACCTCGAGTCTTTCTTCCTCCTCTCGACAGCAAGAGCACAAGCAGCTAGCTACTCCTAGCTAGCAAAGCTAGCAGCTGATGGAGTGAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.60% 36.10% 0.36% 2.01% NA
All Indica  2759 82.50% 15.00% 0.22% 2.32% NA
All Japonica  1512 29.80% 68.80% 0.40% 0.93% NA
Aus  269 33.50% 59.10% 1.49% 5.95% NA
Indica I  595 95.00% 2.70% 0.17% 2.18% NA
Indica II  465 88.80% 10.80% 0.22% 0.22% NA
Indica III  913 73.80% 21.70% 0.22% 4.27% NA
Indica Intermediate  786 79.40% 19.00% 0.25% 1.40% NA
Temperate Japonica  767 50.60% 49.00% 0.39% 0.00% NA
Tropical Japonica  504 8.10% 91.10% 0.40% 0.40% NA
Japonica Intermediate  241 9.10% 85.50% 0.41% 4.98% NA
VI/Aromatic  96 33.30% 64.60% 1.04% 1.04% NA
Intermediate  90 67.80% 32.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1128801321 T -> A LOC_Os11g47760.1 upstream_gene_variant ; 2927.0bp to feature; MODIFIER silent_mutation Average:69.25; most accessible tissue: Zhenshan97 panicle, score: 90.061 N N N N
vg1128801321 T -> A LOC_Os11g47760.2 upstream_gene_variant ; 2927.0bp to feature; MODIFIER silent_mutation Average:69.25; most accessible tissue: Zhenshan97 panicle, score: 90.061 N N N N
vg1128801321 T -> A LOC_Os11g47760.3 upstream_gene_variant ; 2927.0bp to feature; MODIFIER silent_mutation Average:69.25; most accessible tissue: Zhenshan97 panicle, score: 90.061 N N N N
vg1128801321 T -> A LOC_Os11g47760.5 upstream_gene_variant ; 2927.0bp to feature; MODIFIER silent_mutation Average:69.25; most accessible tissue: Zhenshan97 panicle, score: 90.061 N N N N
vg1128801321 T -> A LOC_Os11g47760.6 upstream_gene_variant ; 2927.0bp to feature; MODIFIER silent_mutation Average:69.25; most accessible tissue: Zhenshan97 panicle, score: 90.061 N N N N
vg1128801321 T -> A LOC_Os11g47750.1 downstream_gene_variant ; 1080.0bp to feature; MODIFIER silent_mutation Average:69.25; most accessible tissue: Zhenshan97 panicle, score: 90.061 N N N N
vg1128801321 T -> A LOC_Os11g47740.1 intron_variant ; MODIFIER silent_mutation Average:69.25; most accessible tissue: Zhenshan97 panicle, score: 90.061 N N N N
vg1128801321 T -> DEL N N silent_mutation Average:69.25; most accessible tissue: Zhenshan97 panicle, score: 90.061 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1128801321 T A 0.02 0.0 0.0 0.01 0.02 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1128801321 NA 2.45E-08 mr1260 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128801321 NA 8.63E-08 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128801321 NA 6.39E-09 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128801321 NA 8.26E-06 mr1324 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128801321 9.95E-06 2.90E-06 mr1744 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128801321 NA 1.18E-08 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128801321 NA 1.75E-09 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128801321 NA 2.25E-06 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128801321 NA 1.40E-06 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251