\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128791293:

Variant ID: vg1128791293 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 28791293
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCATAAGCTTGCTGATTGCTGCCTACATTTGCCTAACCAACAGACCTTCTAAGCCTGCCATGTGGCCCACTCGCCTTGCCGGGCCCACCTGTCAGCGAG[A/G]
CACTGTGCAGTTAACAACCCCCTCTCCTCCATTTGCATCTAGATTGCTAGCAACATGATTGATGTCTGACCTAATGGTATTTTGTTTCCATGAGGAAGCA

Reverse complement sequence

TGCTTCCTCATGGAAACAAAATACCATTAGGTCAGACATCAATCATGTTGCTAGCAATCTAGATGCAAATGGAGGAGAGGGGGTTGTTAACTGCACAGTG[T/C]
CTCGCTGACAGGTGGGCCCGGCAAGGCGAGTGGGCCACATGGCAGGCTTAGAAGGTCTGTTGGTTAGGCAAATGTAGGCAGCAATCAGCAAGCTTATGCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.40% 11.10% 0.19% 4.25% NA
All Indica  2759 92.10% 0.40% 0.29% 7.21% NA
All Japonica  1512 66.80% 33.10% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 75.80% 0.20% 0.67% 23.36% NA
Indica II  465 99.10% 0.40% 0.00% 0.43% NA
Indica III  913 95.30% 0.20% 0.44% 4.05% NA
Indica Intermediate  786 96.70% 0.60% 0.00% 2.67% NA
Temperate Japonica  767 89.00% 10.80% 0.13% 0.00% NA
Tropical Japonica  504 31.30% 68.70% 0.00% 0.00% NA
Japonica Intermediate  241 70.10% 29.90% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 84.40% 13.30% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1128791293 A -> DEL N N silent_mutation Average:58.753; most accessible tissue: Callus, score: 99.22 N N N N
vg1128791293 A -> G LOC_Os11g47710.1 upstream_gene_variant ; 3056.0bp to feature; MODIFIER silent_mutation Average:58.753; most accessible tissue: Callus, score: 99.22 N N N N
vg1128791293 A -> G LOC_Os11g47730.1 upstream_gene_variant ; 1849.0bp to feature; MODIFIER silent_mutation Average:58.753; most accessible tissue: Callus, score: 99.22 N N N N
vg1128791293 A -> G LOC_Os11g47730.2 upstream_gene_variant ; 1721.0bp to feature; MODIFIER silent_mutation Average:58.753; most accessible tissue: Callus, score: 99.22 N N N N
vg1128791293 A -> G LOC_Os11g47710-LOC_Os11g47730 intergenic_region ; MODIFIER silent_mutation Average:58.753; most accessible tissue: Callus, score: 99.22 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1128791293 A G 0.01 0.05 0.02 0.0 -0.01 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1128791293 NA 4.07E-06 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128791293 6.06E-06 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128791293 4.02E-08 NA mr1310 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128791293 NA 4.77E-09 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128791293 2.76E-08 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128791293 NA 1.15E-09 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128791293 NA 2.41E-06 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128791293 6.62E-08 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128791293 2.95E-06 NA mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128791293 NA 1.31E-07 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128791293 NA 4.01E-07 mr1321_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128791293 3.83E-08 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128791293 NA 2.65E-06 mr1566_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128791293 7.95E-08 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128791293 NA 1.48E-08 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251