\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128788765:

Variant ID: vg1128788765 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 28788765
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, C: 0.01, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


TCGTGAAACGGAGGAAGTAGTAGCACATAAGCTCAAGCATTTTTTTTCTTTTTTTCTTCTTCGAGAAGTCCAATGCAACCTTCCCTCCCTACAGTCCATC[T/C]
AAATTTATTTGTTATTTTGTTGTGAATCATCCAAATAAGTCATCAATCATGTTAAGTTCATGTGTTTTATATTCCTGTAGGATCGGTACCTTTTTCTGTT

Reverse complement sequence

AACAGAAAAAGGTACCGATCCTACAGGAATATAAAACACATGAACTTAACATGATTGATGACTTATTTGGATGATTCACAACAAAATAACAAATAAATTT[A/G]
GATGGACTGTAGGGAGGGAAGGTTGCATTGGACTTCTCGAAGAAGAAAAAAAGAAAAAAAATGCTTGAGCTTATGTGCTACTACTTCCTCCGTTTCACGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.30% 31.50% 0.13% 0.00% NA
All Indica  2759 72.70% 27.30% 0.07% 0.00% NA
All Japonica  1512 61.40% 38.40% 0.20% 0.00% NA
Aus  269 74.30% 25.30% 0.37% 0.00% NA
Indica I  595 70.90% 28.90% 0.17% 0.00% NA
Indica II  465 84.30% 15.70% 0.00% 0.00% NA
Indica III  913 67.80% 32.20% 0.00% 0.00% NA
Indica Intermediate  786 72.80% 27.10% 0.13% 0.00% NA
Temperate Japonica  767 84.00% 15.60% 0.39% 0.00% NA
Tropical Japonica  504 27.60% 72.40% 0.00% 0.00% NA
Japonica Intermediate  241 60.60% 39.40% 0.00% 0.00% NA
VI/Aromatic  96 30.20% 69.80% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1128788765 T -> C LOC_Os11g47710.1 upstream_gene_variant ; 528.0bp to feature; MODIFIER silent_mutation Average:73.817; most accessible tissue: Callus, score: 85.848 N N N N
vg1128788765 T -> C LOC_Os11g47730.1 upstream_gene_variant ; 4377.0bp to feature; MODIFIER silent_mutation Average:73.817; most accessible tissue: Callus, score: 85.848 N N N N
vg1128788765 T -> C LOC_Os11g47730.2 upstream_gene_variant ; 4249.0bp to feature; MODIFIER silent_mutation Average:73.817; most accessible tissue: Callus, score: 85.848 N N N N
vg1128788765 T -> C LOC_Os11g47680.1 downstream_gene_variant ; 4773.0bp to feature; MODIFIER silent_mutation Average:73.817; most accessible tissue: Callus, score: 85.848 N N N N
vg1128788765 T -> C LOC_Os11g47690.1 downstream_gene_variant ; 4103.0bp to feature; MODIFIER silent_mutation Average:73.817; most accessible tissue: Callus, score: 85.848 N N N N
vg1128788765 T -> C LOC_Os11g47700.1 downstream_gene_variant ; 2978.0bp to feature; MODIFIER silent_mutation Average:73.817; most accessible tissue: Callus, score: 85.848 N N N N
vg1128788765 T -> C LOC_Os11g47710-LOC_Os11g47730 intergenic_region ; MODIFIER silent_mutation Average:73.817; most accessible tissue: Callus, score: 85.848 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1128788765 T C -0.01 -0.01 -0.01 0.0 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1128788765 NA 6.96E-06 mr1300 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128788765 2.13E-06 NA mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128788765 4.95E-07 9.55E-11 mr1310 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128788765 8.27E-06 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128788765 2.70E-06 2.53E-10 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128788765 NA 3.79E-08 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128788765 2.07E-06 2.21E-10 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128788765 NA 4.48E-07 mr1959_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251