\
| Variant ID: vg1128770725 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 28770725 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CCTCCTCTCTCTCTTCTCTTTCCCTTCCTCTCCCTTCCTCATCTCTCTCTCTCACTTATCTGTAAAGCTAGCCGGGGCGAGCAGGAGAGGAGGAGGGCGG[C/T]
GCCACGACGGCGACGGCGGCGGCGGCGGCCATAGTGGGGAAGCACGGCGGAGGCGCGGGGAGCCCGGAACCCTGCCGACGACGGCGAGCCCGTAGCCCTT
AAGGGCTACGGGCTCGCCGTCGTCGGCAGGGTTCCGGGCTCCCCGCGCCTCCGCCGTGCTTCCCCACTATGGCCGCCGCCGCCGCCGTCGCCGTCGTGGC[G/A]
CCGCCCTCCTCCTCTCCTGCTCGCCCCGGCTAGCTTTACAGATAAGTGAGAGAGAGAGATGAGGAAGGGAGAGGAAGGGAAAGAGAAGAGAGAGAGGAGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.10% | 13.40% | 0.57% | 0.89% | NA |
| All Indica | 2759 | 98.60% | 1.10% | 0.14% | 0.14% | NA |
| All Japonica | 1512 | 58.70% | 37.50% | 1.39% | 2.45% | NA |
| Aus | 269 | 98.10% | 1.10% | 0.37% | 0.37% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.70% | 1.00% | 0.00% | 0.33% | NA |
| Indica Intermediate | 786 | 96.90% | 2.40% | 0.51% | 0.13% | NA |
| Temperate Japonica | 767 | 74.10% | 18.50% | 2.61% | 4.82% | NA |
| Tropical Japonica | 504 | 31.00% | 68.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 67.60% | 32.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 81.20% | 18.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 15.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1128770725 | C -> T | LOC_Os11g47630.1 | upstream_gene_variant ; 3788.0bp to feature; MODIFIER | silent_mutation | Average:63.437; most accessible tissue: Minghui63 panicle, score: 87.951 | N | N | N | N |
| vg1128770725 | C -> T | LOC_Os11g47650.1 | upstream_gene_variant ; 3710.0bp to feature; MODIFIER | silent_mutation | Average:63.437; most accessible tissue: Minghui63 panicle, score: 87.951 | N | N | N | N |
| vg1128770725 | C -> T | LOC_Os11g47650.2 | upstream_gene_variant ; 3710.0bp to feature; MODIFIER | silent_mutation | Average:63.437; most accessible tissue: Minghui63 panicle, score: 87.951 | N | N | N | N |
| vg1128770725 | C -> T | LOC_Os11g47640.1 | intron_variant ; MODIFIER | silent_mutation | Average:63.437; most accessible tissue: Minghui63 panicle, score: 87.951 | N | N | N | N |
| vg1128770725 | C -> DEL | N | N | silent_mutation | Average:63.437; most accessible tissue: Minghui63 panicle, score: 87.951 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1128770725 | 2.61E-06 | NA | mr1261 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128770725 | 5.91E-07 | NA | mr1310 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128770725 | NA | 2.43E-07 | mr1310 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128770725 | NA | 1.23E-07 | mr1800 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128770725 | 6.33E-06 | NA | mr1926 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128770725 | NA | 6.16E-09 | mr1942 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128770725 | 5.49E-06 | NA | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128770725 | 2.54E-06 | NA | mr1310_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128770725 | 6.52E-06 | NA | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128770725 | NA | 2.82E-06 | mr1566_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128770725 | NA | 1.54E-08 | mr1905_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |