Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128770725:

Variant ID: vg1128770725 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 28770725
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCTCCTCTCTCTCTTCTCTTTCCCTTCCTCTCCCTTCCTCATCTCTCTCTCTCACTTATCTGTAAAGCTAGCCGGGGCGAGCAGGAGAGGAGGAGGGCGG[C/T]
GCCACGACGGCGACGGCGGCGGCGGCGGCCATAGTGGGGAAGCACGGCGGAGGCGCGGGGAGCCCGGAACCCTGCCGACGACGGCGAGCCCGTAGCCCTT

Reverse complement sequence

AAGGGCTACGGGCTCGCCGTCGTCGGCAGGGTTCCGGGCTCCCCGCGCCTCCGCCGTGCTTCCCCACTATGGCCGCCGCCGCCGCCGTCGCCGTCGTGGC[G/A]
CCGCCCTCCTCCTCTCCTGCTCGCCCCGGCTAGCTTTACAGATAAGTGAGAGAGAGAGATGAGGAAGGGAGAGGAAGGGAAAGAGAAGAGAGAGAGGAGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.10%	13.40%	0.57%	0.89%	NA
All Indica	2759	98.60%	1.10%	0.14%	0.14%	NA
All Japonica	1512	58.70%	37.50%	1.39%	2.45%	NA
Aus	269	98.10%	1.10%	0.37%	0.37%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.60%	0.40%	0.00%	0.00%	NA
Indica III	913	98.70%	1.00%	0.00%	0.33%	NA
Indica Intermediate	786	96.90%	2.40%	0.51%	0.13%	NA
Temperate Japonica	767	74.10%	18.50%	2.61%	4.82%	NA
Tropical Japonica	504	31.00%	68.80%	0.20%	0.00%	NA
Japonica Intermediate	241	67.60%	32.40%	0.00%	0.00%	NA
VI/Aromatic	96	81.20%	18.80%	0.00%	0.00%	NA
Intermediate	90	83.30%	15.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1128770725	C -> T	LOC_Os11g47630.1	upstream_gene_variant ; 3788.0bp to feature; MODIFIER	silent_mutation	Average:63.437; most accessible tissue: Minghui63 panicle, score: 87.951	N	N	N	N
vg1128770725	C -> T	LOC_Os11g47650.1	upstream_gene_variant ; 3710.0bp to feature; MODIFIER	silent_mutation	Average:63.437; most accessible tissue: Minghui63 panicle, score: 87.951	N	N	N	N
vg1128770725	C -> T	LOC_Os11g47650.2	upstream_gene_variant ; 3710.0bp to feature; MODIFIER	silent_mutation	Average:63.437; most accessible tissue: Minghui63 panicle, score: 87.951	N	N	N	N
vg1128770725	C -> T	LOC_Os11g47640.1	intron_variant ; MODIFIER	silent_mutation	Average:63.437; most accessible tissue: Minghui63 panicle, score: 87.951	N	N	N	N
vg1128770725	C -> DEL	N	N	silent_mutation	Average:63.437; most accessible tissue: Minghui63 panicle, score: 87.951	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1128770725	2.61E-06	NA	mr1261	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128770725	5.91E-07	NA	mr1310	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128770725	NA	2.43E-07	mr1310	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128770725	NA	1.23E-07	mr1800	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128770725	6.33E-06	NA	mr1926	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128770725	NA	6.16E-09	mr1942	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128770725	5.49E-06	NA	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128770725	2.54E-06	NA	mr1310_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128770725	6.52E-06	NA	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128770725	NA	2.82E-06	mr1566_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128770725	NA	1.54E-08	mr1905_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251