\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128770725:

Variant ID: vg1128770725 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 28770725
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTCCTCTCTCTCTTCTCTTTCCCTTCCTCTCCCTTCCTCATCTCTCTCTCTCACTTATCTGTAAAGCTAGCCGGGGCGAGCAGGAGAGGAGGAGGGCGG[C/T]
GCCACGACGGCGACGGCGGCGGCGGCGGCCATAGTGGGGAAGCACGGCGGAGGCGCGGGGAGCCCGGAACCCTGCCGACGACGGCGAGCCCGTAGCCCTT

Reverse complement sequence

AAGGGCTACGGGCTCGCCGTCGTCGGCAGGGTTCCGGGCTCCCCGCGCCTCCGCCGTGCTTCCCCACTATGGCCGCCGCCGCCGCCGTCGCCGTCGTGGC[G/A]
CCGCCCTCCTCCTCTCCTGCTCGCCCCGGCTAGCTTTACAGATAAGTGAGAGAGAGAGATGAGGAAGGGAGAGGAAGGGAAAGAGAAGAGAGAGAGGAGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.10% 13.40% 0.57% 0.89% NA
All Indica  2759 98.60% 1.10% 0.14% 0.14% NA
All Japonica  1512 58.70% 37.50% 1.39% 2.45% NA
Aus  269 98.10% 1.10% 0.37% 0.37% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 98.70% 1.00% 0.00% 0.33% NA
Indica Intermediate  786 96.90% 2.40% 0.51% 0.13% NA
Temperate Japonica  767 74.10% 18.50% 2.61% 4.82% NA
Tropical Japonica  504 31.00% 68.80% 0.20% 0.00% NA
Japonica Intermediate  241 67.60% 32.40% 0.00% 0.00% NA
VI/Aromatic  96 81.20% 18.80% 0.00% 0.00% NA
Intermediate  90 83.30% 15.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1128770725 C -> T LOC_Os11g47630.1 upstream_gene_variant ; 3788.0bp to feature; MODIFIER silent_mutation Average:63.437; most accessible tissue: Minghui63 panicle, score: 87.951 N N N N
vg1128770725 C -> T LOC_Os11g47650.1 upstream_gene_variant ; 3710.0bp to feature; MODIFIER silent_mutation Average:63.437; most accessible tissue: Minghui63 panicle, score: 87.951 N N N N
vg1128770725 C -> T LOC_Os11g47650.2 upstream_gene_variant ; 3710.0bp to feature; MODIFIER silent_mutation Average:63.437; most accessible tissue: Minghui63 panicle, score: 87.951 N N N N
vg1128770725 C -> T LOC_Os11g47640.1 intron_variant ; MODIFIER silent_mutation Average:63.437; most accessible tissue: Minghui63 panicle, score: 87.951 N N N N
vg1128770725 C -> DEL N N silent_mutation Average:63.437; most accessible tissue: Minghui63 panicle, score: 87.951 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1128770725 2.61E-06 NA mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128770725 5.91E-07 NA mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128770725 NA 2.43E-07 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128770725 NA 1.23E-07 mr1800 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128770725 6.33E-06 NA mr1926 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128770725 NA 6.16E-09 mr1942 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128770725 5.49E-06 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128770725 2.54E-06 NA mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128770725 6.52E-06 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128770725 NA 2.82E-06 mr1566_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128770725 NA 1.54E-08 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251