\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128769420:

Variant ID: vg1128769420 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 28769420
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACAAGATTTCGGCAATACTAAAATGGGTGGCTATCAAGCTAGAAAAGTCGATGGGTTTGGAAACAAGGAATTTTATATAGGTTCAGGCTTTCTTAATCA[A/G]
GAAGTAATACCCTACTTGTAGTGTGGATTGGAAACATATTGAACCCAAAATATGCAAGCTTTCCAGATTCTAATCCGTGTTTTCGAGAGATTCTGGAGAA

Reverse complement sequence

TTCTCCAGAATCTCTCGAAAACACGGATTAGAATCTGGAAAGCTTGCATATTTTGGGTTCAATATGTTTCCAATCCACACTACAAGTAGGGTATTACTTC[T/C]
TGATTAAGAAAGCCTGAACCTATATAAAATTCCTTGTTTCCAAACCCATCGACTTTTCTAGCTTGATAGCCACCCATTTTAGTATTGCCGAAATCTTGTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.10% 10.80% 2.26% 2.81% NA
All Indica  2759 93.60% 0.30% 3.59% 2.46% NA
All Japonica  1512 63.40% 32.30% 0.46% 3.84% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 98.80% 0.20% 0.00% 1.01% NA
Indica II  465 94.20% 0.40% 0.43% 4.95% NA
Indica III  913 87.50% 0.10% 9.20% 3.18% NA
Indica Intermediate  786 96.40% 0.60% 1.65% 1.27% NA
Temperate Japonica  767 83.10% 10.30% 0.78% 5.87% NA
Tropical Japonica  504 31.20% 66.50% 0.00% 2.38% NA
Japonica Intermediate  241 68.00% 31.10% 0.41% 0.41% NA
VI/Aromatic  96 95.80% 2.10% 1.04% 1.04% NA
Intermediate  90 83.30% 11.10% 0.00% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1128769420 A -> DEL N N silent_mutation Average:42.408; most accessible tissue: Zhenshan97 root, score: 84.212 N N N N
vg1128769420 A -> G LOC_Os11g47630.1 upstream_gene_variant ; 2483.0bp to feature; MODIFIER silent_mutation Average:42.408; most accessible tissue: Zhenshan97 root, score: 84.212 N N N N
vg1128769420 A -> G LOC_Os11g47640.1 upstream_gene_variant ; 184.0bp to feature; MODIFIER silent_mutation Average:42.408; most accessible tissue: Zhenshan97 root, score: 84.212 N N N N
vg1128769420 A -> G LOC_Os11g47630-LOC_Os11g47640 intergenic_region ; MODIFIER silent_mutation Average:42.408; most accessible tissue: Zhenshan97 root, score: 84.212 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1128769420 1.35E-07 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128769420 4.98E-06 NA mr1261 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128769420 1.14E-07 NA mr1309 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128769420 3.48E-06 NA mr1310 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128769420 NA 1.09E-07 mr1310 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128769420 NA 5.00E-07 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128769420 4.89E-06 9.41E-16 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128769420 4.99E-06 NA mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128769420 NA 4.54E-13 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128769420 NA 2.23E-07 mr1926 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128769420 NA 6.15E-08 mr1942 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128769420 1.72E-09 3.27E-28 mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128769420 3.37E-06 NA mr1310_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128769420 NA 2.24E-07 mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128769420 NA 3.44E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128769420 6.53E-09 8.80E-26 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128769420 NA 2.31E-07 mr1566_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128769420 3.18E-08 NA mr1841_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128769420 3.13E-06 1.07E-19 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128769420 NA 2.51E-10 mr1905_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128769420 2.35E-06 1.29E-18 mr1945_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251