\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128664243:

Variant ID: vg1128664243 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 28664243
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTGGCGTCCTTGGCCACCCAGCGCGCCAATGATCTGGTGCACGACCTGTTGGAGACCCGCGAGGATCTCCTGAAGATGAGGGAGCTGGTGGCCGGCAAC[G/A]
AAATGCAGCGGCAGGGACTCGAGCGCCGGATGTCGGAGCTCGAGAACAACCTGGCGGAGATCCACGGGTCACTGCGGACATCGTACACCGGGTTGCATCA

Reverse complement sequence

TGATGCAACCCGGTGTACGATGTCCGCAGTGACCCGTGGATCTCCGCCAGGTTGTTCTCGAGCTCCGACATCCGGCGCTCGAGTCCCTGCCGCTGCATTT[C/T]
GTTGCCGGCCACCAGCTCCCTCATCTTCAGGAGATCCTCGCGGGTCTCCAACAGGTCGTGCACCAGATCATTGGCGCGCTGGGTGGCCAAGGACGCCACT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.90% 10.40% 2.79% 10.96% NA
All Indica  2759 75.70% 4.00% 4.46% 15.88% NA
All Japonica  1512 70.60% 24.50% 0.20% 4.63% NA
Aus  269 98.10% 0.70% 0.37% 0.74% NA
Indica I  595 87.20% 0.80% 1.85% 10.08% NA
Indica II  465 75.90% 5.20% 3.01% 15.91% NA
Indica III  913 67.30% 3.90% 6.35% 22.45% NA
Indica Intermediate  786 76.60% 5.70% 5.09% 12.60% NA
Temperate Japonica  767 63.20% 33.00% 0.26% 3.52% NA
Tropical Japonica  504 83.50% 11.50% 0.00% 4.96% NA
Japonica Intermediate  241 67.20% 24.90% 0.41% 7.47% NA
VI/Aromatic  96 96.90% 0.00% 0.00% 3.12% NA
Intermediate  90 80.00% 8.90% 5.56% 5.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1128664243 G -> A LOC_Os11g47448.1 missense_variant ; p.Glu204Lys; MODERATE nonsynonymous_codon ; E204K Average:77.433; most accessible tissue: Minghui63 young leaf, score: 92.277 benign 0.481 DELETERIOUS 0.03
vg1128664243 G -> DEL LOC_Os11g47448.1 N frameshift_variant Average:77.433; most accessible tissue: Minghui63 young leaf, score: 92.277 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1128664243 G A -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1128664243 1.57E-06 2.57E-09 mr1942 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251