\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128649409:

Variant ID: vg1128649409 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 28649409
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


AATTGCAATGGCGAGGAATACTGTGAGCATTACATGACAGTCATGGGAATTGTAGCTTAAAAGCGACAGATCCTTCATCGACACTAGTCGCTTAATGTTT[G/A]
AGGAGAAGCCAGTAGGCACTCTCACCCCATGTAGGGATTTGCACAATGCCATTTTCTCCTCTCTTGTCAAGGTGTAGCAAGCAGGCGGAAGGTACACTTT

Reverse complement sequence

AAAGTGTACCTTCCGCCTGCTTGCTACACCTTGACAAGAGAGGAGAAAATGGCATTGTGCAAATCCCTACATGGGGTGAGAGTGCCTACTGGCTTCTCCT[C/T]
AAACATTAAGCGACTAGTGTCGATGAAGGATCTGTCGCTTTTAAGCTACAATTCCCATGACTGTCATGTAATGCTCACAGTATTCCTCGCCATTGCAATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 77.90% 5.00% 0.78% 16.34% NA
All Indica  2759 74.10% 0.40% 1.09% 24.43% NA
All Japonica  1512 84.50% 11.00% 0.26% 4.17% NA
Aus  269 73.60% 18.20% 0.74% 7.43% NA
Indica I  595 81.80% 0.30% 0.84% 16.97% NA
Indica II  465 68.20% 0.20% 0.22% 31.40% NA
Indica III  913 72.20% 0.00% 1.97% 25.85% NA
Indica Intermediate  786 73.90% 1.00% 0.76% 24.30% NA
Temperate Japonica  767 93.70% 1.80% 0.52% 3.91% NA
Tropical Japonica  504 74.60% 22.60% 0.00% 2.78% NA
Japonica Intermediate  241 75.90% 16.20% 0.00% 7.88% NA
VI/Aromatic  96 93.80% 0.00% 0.00% 6.25% NA
Intermediate  90 81.10% 7.80% 1.11% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1128649409 G -> A LOC_Os11g47445.1 upstream_gene_variant ; 4975.0bp to feature; MODIFIER silent_mutation Average:30.7; most accessible tissue: Minghui63 young leaf, score: 49.581 N N N N
vg1128649409 G -> A LOC_Os11g47447.1 upstream_gene_variant ; 4102.0bp to feature; MODIFIER silent_mutation Average:30.7; most accessible tissue: Minghui63 young leaf, score: 49.581 N N N N
vg1128649409 G -> A LOC_Os11g47446.1 intron_variant ; MODIFIER silent_mutation Average:30.7; most accessible tissue: Minghui63 young leaf, score: 49.581 N N N N
vg1128649409 G -> DEL N N silent_mutation Average:30.7; most accessible tissue: Minghui63 young leaf, score: 49.581 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1128649409 7.18E-06 7.18E-06 mr1041 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128649409 NA 9.01E-06 mr1044 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128649409 NA 3.02E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128649409 NA 2.90E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128649409 3.18E-06 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128649409 3.00E-06 7.26E-10 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128649409 1.62E-06 1.62E-06 mr1145 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128649409 NA 1.12E-06 mr1159 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128649409 NA 3.08E-07 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128649409 NA 7.74E-06 mr1283 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128649409 4.01E-07 1.36E-11 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128649409 2.61E-06 2.60E-06 mr1299 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128649409 2.43E-06 4.04E-10 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128649409 NA 1.63E-06 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128649409 6.23E-08 3.87E-10 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128649409 4.81E-06 NA mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128649409 NA 6.57E-08 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128649409 5.75E-06 5.74E-06 mr1605 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128649409 NA 8.75E-06 mr1632 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128649409 NA 4.72E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128649409 NA 5.31E-08 mr1639 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128649409 2.04E-06 8.48E-07 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128649409 9.04E-06 NA mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128649409 NA 6.87E-07 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128649409 NA 1.88E-08 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128649409 1.51E-06 1.52E-06 mr1823 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128649409 NA 4.24E-07 mr1852 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128649409 NA 2.85E-06 mr1876 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128649409 NA 5.52E-06 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128649409 NA 4.69E-06 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251