\
| Variant ID: vg1128647951 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 28647951 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CCCCCCAAATATTTCTGCATTCCTCCAAATTTTACCAACCAATTTGTATTCATCCAAAATTCATCTCAACCATTTGCAACAACCAACCCTAAATCATCTA[T/A]
ACATTCATGTTTTTAAATCACATTTGCAACTATTGCAGTGCCATCTGCCACATTGCAAAACCCCTGCAAACCCCCCAACCACATTGCATTCACCCAAATT
AATTTGGGTGAATGCAATGTGGTTGGGGGGTTTGCAGGGGTTTTGCAATGTGGCAGATGGCACTGCAATAGTTGCAAATGTGATTTAAAAACATGAATGT[A/T]
TAGATGATTTAGGGTTGGTTGTTGCAAATGGTTGAGATGAATTTTGGATGAATACAAATTGGTTGGTAAAATTTGGAGGAATGCAGAAATATTTGGGGGG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 64.90% | 5.20% | 1.40% | 28.50% | NA |
| All Indica | 2759 | 56.30% | 0.40% | 1.59% | 41.72% | NA |
| All Japonica | 1512 | 84.00% | 11.00% | 0.20% | 4.76% | NA |
| Aus | 269 | 31.60% | 23.00% | 6.69% | 38.66% | NA |
| Indica I | 595 | 79.00% | 0.30% | 0.84% | 19.83% | NA |
| Indica II | 465 | 49.70% | 0.20% | 2.15% | 47.96% | NA |
| Indica III | 913 | 45.10% | 0.00% | 1.64% | 53.23% | NA |
| Indica Intermediate | 786 | 56.00% | 1.00% | 1.78% | 41.22% | NA |
| Temperate Japonica | 767 | 94.10% | 1.80% | 0.13% | 3.91% | NA |
| Tropical Japonica | 504 | 73.40% | 22.60% | 0.20% | 3.77% | NA |
| Japonica Intermediate | 241 | 73.90% | 16.20% | 0.41% | 9.54% | NA |
| VI/Aromatic | 96 | 93.80% | 0.00% | 0.00% | 6.25% | NA |
| Intermediate | 90 | 75.60% | 7.80% | 1.11% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1128647951 | T -> A | LOC_Os11g47445.1 | upstream_gene_variant ; 3517.0bp to feature; MODIFIER | silent_mutation | Average:32.631; most accessible tissue: Callus, score: 51.921 | N | N | N | N |
| vg1128647951 | T -> A | LOC_Os11g47446.1 | intron_variant ; MODIFIER | silent_mutation | Average:32.631; most accessible tissue: Callus, score: 51.921 | N | N | N | N |
| vg1128647951 | T -> DEL | N | N | silent_mutation | Average:32.631; most accessible tissue: Callus, score: 51.921 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1128647951 | 7.18E-06 | 7.18E-06 | mr1041 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128647951 | NA | 9.01E-06 | mr1044 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128647951 | NA | 3.02E-06 | mr1076 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128647951 | NA | 2.90E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128647951 | 1.72E-06 | NA | mr1083 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128647951 | 3.00E-06 | 7.26E-10 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128647951 | 1.62E-06 | 1.62E-06 | mr1145 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128647951 | NA | 1.12E-06 | mr1159 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128647951 | NA | 5.99E-06 | mr1207 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128647951 | NA | 3.08E-07 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128647951 | 2.85E-06 | NA | mr1227 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128647951 | NA | 9.03E-06 | mr1283 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128647951 | 5.60E-07 | 2.51E-11 | mr1299 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128647951 | 2.61E-06 | 2.60E-06 | mr1299 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128647951 | 1.73E-06 | 3.71E-10 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128647951 | 6.07E-06 | 9.20E-06 | mr1400 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128647951 | NA | 1.63E-06 | mr1408 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128647951 | 1.20E-07 | 9.04E-10 | mr1427 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128647951 | 1.83E-06 | NA | mr1560 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128647951 | NA | 6.57E-08 | mr1560 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128647951 | 7.45E-06 | 7.44E-06 | mr1605 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128647951 | NA | 8.75E-06 | mr1632 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128647951 | NA | 4.95E-06 | mr1634 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128647951 | NA | 5.31E-08 | mr1639 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128647951 | 1.80E-06 | 7.79E-07 | mr1665 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128647951 | NA | 6.87E-07 | mr1700 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128647951 | NA | 3.87E-08 | mr1756 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128647951 | 1.84E-06 | 1.85E-06 | mr1823 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128647951 | NA | 1.27E-06 | mr1852 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128647951 | NA | 1.93E-06 | mr1876 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128647951 | NA | 5.52E-06 | mr1082_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128647951 | NA | 4.69E-06 | mr1083_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |