\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128647951:

Variant ID: vg1128647951 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 28647951
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCCCCCAAATATTTCTGCATTCCTCCAAATTTTACCAACCAATTTGTATTCATCCAAAATTCATCTCAACCATTTGCAACAACCAACCCTAAATCATCTA[T/A]
ACATTCATGTTTTTAAATCACATTTGCAACTATTGCAGTGCCATCTGCCACATTGCAAAACCCCTGCAAACCCCCCAACCACATTGCATTCACCCAAATT

Reverse complement sequence

AATTTGGGTGAATGCAATGTGGTTGGGGGGTTTGCAGGGGTTTTGCAATGTGGCAGATGGCACTGCAATAGTTGCAAATGTGATTTAAAAACATGAATGT[A/T]
TAGATGATTTAGGGTTGGTTGTTGCAAATGGTTGAGATGAATTTTGGATGAATACAAATTGGTTGGTAAAATTTGGAGGAATGCAGAAATATTTGGGGGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.90% 5.20% 1.40% 28.50% NA
All Indica  2759 56.30% 0.40% 1.59% 41.72% NA
All Japonica  1512 84.00% 11.00% 0.20% 4.76% NA
Aus  269 31.60% 23.00% 6.69% 38.66% NA
Indica I  595 79.00% 0.30% 0.84% 19.83% NA
Indica II  465 49.70% 0.20% 2.15% 47.96% NA
Indica III  913 45.10% 0.00% 1.64% 53.23% NA
Indica Intermediate  786 56.00% 1.00% 1.78% 41.22% NA
Temperate Japonica  767 94.10% 1.80% 0.13% 3.91% NA
Tropical Japonica  504 73.40% 22.60% 0.20% 3.77% NA
Japonica Intermediate  241 73.90% 16.20% 0.41% 9.54% NA
VI/Aromatic  96 93.80% 0.00% 0.00% 6.25% NA
Intermediate  90 75.60% 7.80% 1.11% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1128647951 T -> A LOC_Os11g47445.1 upstream_gene_variant ; 3517.0bp to feature; MODIFIER silent_mutation Average:32.631; most accessible tissue: Callus, score: 51.921 N N N N
vg1128647951 T -> A LOC_Os11g47446.1 intron_variant ; MODIFIER silent_mutation Average:32.631; most accessible tissue: Callus, score: 51.921 N N N N
vg1128647951 T -> DEL N N silent_mutation Average:32.631; most accessible tissue: Callus, score: 51.921 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1128647951 7.18E-06 7.18E-06 mr1041 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128647951 NA 9.01E-06 mr1044 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128647951 NA 3.02E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128647951 NA 2.90E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128647951 1.72E-06 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128647951 3.00E-06 7.26E-10 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128647951 1.62E-06 1.62E-06 mr1145 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128647951 NA 1.12E-06 mr1159 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128647951 NA 5.99E-06 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128647951 NA 3.08E-07 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128647951 2.85E-06 NA mr1227 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128647951 NA 9.03E-06 mr1283 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128647951 5.60E-07 2.51E-11 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128647951 2.61E-06 2.60E-06 mr1299 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128647951 1.73E-06 3.71E-10 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128647951 6.07E-06 9.20E-06 mr1400 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128647951 NA 1.63E-06 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128647951 1.20E-07 9.04E-10 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128647951 1.83E-06 NA mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128647951 NA 6.57E-08 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128647951 7.45E-06 7.44E-06 mr1605 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128647951 NA 8.75E-06 mr1632 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128647951 NA 4.95E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128647951 NA 5.31E-08 mr1639 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128647951 1.80E-06 7.79E-07 mr1665 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128647951 NA 6.87E-07 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128647951 NA 3.87E-08 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128647951 1.84E-06 1.85E-06 mr1823 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128647951 NA 1.27E-06 mr1852 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128647951 NA 1.93E-06 mr1876 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128647951 NA 5.52E-06 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128647951 NA 4.69E-06 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251