Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128579692:

Variant ID: vg1128579692 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 28579692
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGGACCCATCATTATATATGCAAGATGAAGTGAATCACTTCAAGTCATCTAACACACATAATGAAACATCCGACGTCTCGAGAGAAGGATATTGGCGACA[C/T]
GGGTGGTCCTTTAGCCTGCTAGTCAACTTCAGCCTGAGATGTACCCGTCAAACCACACGAAAGCGGCGACCAGATATGTTACACATTCCGACTTGACAAA

Reverse complement sequence

TTTGTCAAGTCGGAATGTGTAACATATCTGGTCGCCGCTTTCGTGTGGTTTGACGGGTACATCTCAGGCTGAAGTTGACTAGCAGGCTAAAGGACCACCC[G/A]
TGTCGCCAATATCCTTCTCTCGAGACGTCGGATGTTTCATTATGTGTGTTAGATGACTTGAAGTGATTCACTTCATCTTGCATATATAATGATGGGTCCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	48.90%	0.50%	2.54%	48.10%	NA
All Indica	2759	44.50%	0.10%	1.01%	54.40%	NA
All Japonica	1512	57.40%	1.10%	4.89%	36.64%	NA
Aus	269	24.20%	1.50%	5.95%	68.40%	NA
Indica I	595	63.70%	0.20%	1.18%	34.96%	NA
Indica II	465	27.50%	0.00%	0.86%	71.61%	NA
Indica III	913	41.90%	0.00%	0.55%	57.50%	NA
Indica Intermediate	786	43.00%	0.10%	1.53%	55.34%	NA
Temperate Japonica	767	58.10%	0.30%	1.56%	40.03%	NA
Tropical Japonica	504	60.90%	2.40%	8.53%	28.17%	NA
Japonica Intermediate	241	47.70%	0.80%	7.88%	43.57%	NA
VI/Aromatic	96	93.80%	0.00%	0.00%	6.25%	NA
Intermediate	90	66.70%	0.00%	2.22%	31.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1128579692	C -> T	LOC_Os11g47436.1	downstream_gene_variant ; 2202.0bp to feature; MODIFIER	silent_mutation	Average:17.331; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg1128579692	C -> T	LOC_Os11g47436-LOC_Os11g47438	intergenic_region ; MODIFIER	silent_mutation	Average:17.331; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N
vg1128579692	C -> DEL	N	N	silent_mutation	Average:17.331; most accessible tissue: Minghui63 panicle, score: 34.226	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1128579692	NA	3.73E-06	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692	NA	1.33E-06	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692	3.75E-06	NA	mr1083	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692	6.63E-06	6.55E-09	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692	5.26E-06	NA	mr1085	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692	3.04E-06	3.04E-06	mr1085	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692	7.91E-06	7.91E-06	mr1145	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692	NA	9.74E-07	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692	2.63E-07	1.46E-12	mr1299	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692	2.22E-06	2.22E-06	mr1299	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692	NA	2.90E-06	mr1304	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692	NA	8.31E-09	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692	NA	3.60E-06	mr1408	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692	7.19E-08	3.68E-10	mr1427	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692	3.17E-07	NA	mr1560	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692	NA	2.21E-08	mr1560	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692	NA	4.35E-06	mr1634	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692	NA	2.68E-07	mr1639	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692	NA	3.08E-06	mr1661	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692	NA	1.65E-06	mr1700	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692	NA	2.66E-06	mr1727	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692	NA	5.88E-08	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692	NA	3.77E-07	mr1852	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692	NA	4.30E-06	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692	9.59E-06	NA	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251