\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128579692:

Variant ID: vg1128579692 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 28579692
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGGACCCATCATTATATATGCAAGATGAAGTGAATCACTTCAAGTCATCTAACACACATAATGAAACATCCGACGTCTCGAGAGAAGGATATTGGCGACA[C/T]
GGGTGGTCCTTTAGCCTGCTAGTCAACTTCAGCCTGAGATGTACCCGTCAAACCACACGAAAGCGGCGACCAGATATGTTACACATTCCGACTTGACAAA

Reverse complement sequence

TTTGTCAAGTCGGAATGTGTAACATATCTGGTCGCCGCTTTCGTGTGGTTTGACGGGTACATCTCAGGCTGAAGTTGACTAGCAGGCTAAAGGACCACCC[G/A]
TGTCGCCAATATCCTTCTCTCGAGACGTCGGATGTTTCATTATGTGTGTTAGATGACTTGAAGTGATTCACTTCATCTTGCATATATAATGATGGGTCCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.90% 0.50% 2.54% 48.10% NA
All Indica  2759 44.50% 0.10% 1.01% 54.40% NA
All Japonica  1512 57.40% 1.10% 4.89% 36.64% NA
Aus  269 24.20% 1.50% 5.95% 68.40% NA
Indica I  595 63.70% 0.20% 1.18% 34.96% NA
Indica II  465 27.50% 0.00% 0.86% 71.61% NA
Indica III  913 41.90% 0.00% 0.55% 57.50% NA
Indica Intermediate  786 43.00% 0.10% 1.53% 55.34% NA
Temperate Japonica  767 58.10% 0.30% 1.56% 40.03% NA
Tropical Japonica  504 60.90% 2.40% 8.53% 28.17% NA
Japonica Intermediate  241 47.70% 0.80% 7.88% 43.57% NA
VI/Aromatic  96 93.80% 0.00% 0.00% 6.25% NA
Intermediate  90 66.70% 0.00% 2.22% 31.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1128579692 C -> T LOC_Os11g47436.1 downstream_gene_variant ; 2202.0bp to feature; MODIFIER silent_mutation Average:17.331; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg1128579692 C -> T LOC_Os11g47436-LOC_Os11g47438 intergenic_region ; MODIFIER silent_mutation Average:17.331; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N
vg1128579692 C -> DEL N N silent_mutation Average:17.331; most accessible tissue: Minghui63 panicle, score: 34.226 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1128579692 NA 3.73E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692 NA 1.33E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692 3.75E-06 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692 6.63E-06 6.55E-09 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692 5.26E-06 NA mr1085 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692 3.04E-06 3.04E-06 mr1085 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692 7.91E-06 7.91E-06 mr1145 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692 NA 9.74E-07 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692 2.63E-07 1.46E-12 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692 2.22E-06 2.22E-06 mr1299 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692 NA 2.90E-06 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692 NA 8.31E-09 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692 NA 3.60E-06 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692 7.19E-08 3.68E-10 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692 3.17E-07 NA mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692 NA 2.21E-08 mr1560 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692 NA 4.35E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692 NA 2.68E-07 mr1639 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692 NA 3.08E-06 mr1661 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692 NA 1.65E-06 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692 NA 2.66E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692 NA 5.88E-08 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692 NA 3.77E-07 mr1852 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692 NA 4.30E-06 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128579692 9.59E-06 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251