Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1128516527:

Variant ID: vg1128516527 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 28516527
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATATAATACAAATTTTCATTTATTTATAATATATAGCACATATGACAAATACTTCATTGCCTTTGCAGGAACAAACCAGCAGCGGCCCTCTTATTAAAAA[C/T]
AGATCCATCTCACTGCTACCCGTGAAGCAAGAGCTAGAGGATAGTGACCAGGAAATCACGAGTGAAGATGAACTCACTTCGTCTGACAAACCTCCCAGTT

Reverse complement sequence

AACTGGGAGGTTTGTCAGACGAAGTGAGTTCATCTTCACTCGTGATTTCCTGGTCACTATCCTCTAGCTCTTGCTTCACGGGTAGCAGTGAGATGGATCT[G/A]
TTTTTAATAAGAGGGCCGCTGCTGGTTTGTTCCTGCAAAGGCAATGAAGTATTTGTCATATGTGCTATATATTATAAATAAATGAAAATTTGTATTATAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.00% 6.10% 7.09% 5.76% NA
All Indica  2759 89.10% 7.90% 2.97% 0.11% NA
All Japonica  1512 66.30% 0.30% 15.61% 17.72% NA
Aus  269 72.10% 24.20% 3.72% 0.00% NA
Indica I  595 93.90% 3.90% 2.02% 0.17% NA
Indica II  465 79.10% 14.60% 6.24% 0.00% NA
Indica III  913 93.60% 5.30% 1.10% 0.00% NA
Indica Intermediate  786 85.90% 9.90% 3.94% 0.25% NA
Temperate Japonica  767 53.30% 0.10% 19.43% 27.12% NA
Tropical Japonica  504 87.30% 0.60% 8.53% 3.57% NA
Japonica Intermediate  241 63.90% 0.40% 18.26% 17.43% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 2.20% 7.78% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1128516527 C -> T LOC_Os11g47400.1 synonymous_variant ; p.Asn191Asn; LOW synonymous_codon Average:38.75; most accessible tissue: Callus, score: 59.738 N N N N
vg1128516527 C -> DEL LOC_Os11g47400.1 N frameshift_variant Average:38.75; most accessible tissue: Callus, score: 59.738 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1128516527 1.44E-07 3.07E-13 mr1317 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128516527 5.05E-07 3.25E-15 mr1317 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128516527 NA 4.14E-07 mr1585 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128516527 1.44E-06 NA mr1610 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128516527 4.14E-06 2.20E-07 mr1610 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128516527 NA 1.77E-08 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128516527 1.51E-06 3.09E-28 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128516527 NA 5.53E-24 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128516527 NA 1.35E-06 mr1897 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128516527 NA 9.10E-08 mr1914 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128516527 1.98E-07 NA mr1927 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128516527 1.05E-06 9.94E-10 mr1927 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128516527 NA 4.03E-07 mr1129_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128516527 NA 1.33E-07 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128516527 NA 4.50E-06 mr1255_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128516527 NA 1.44E-06 mr1257_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128516527 NA 2.79E-14 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128516527 NA 2.59E-16 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128516527 NA 4.33E-06 mr1585_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128516527 NA 1.45E-07 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128516527 NA 2.06E-06 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128516527 NA 3.56E-11 mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128516527 NA 4.43E-11 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128516527 NA 3.38E-07 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128516527 NA 4.66E-12 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128516527 NA 3.81E-11 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128516527 3.99E-17 8.59E-45 mr1855_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128516527 3.24E-14 4.25E-36 mr1855_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128516527 NA 3.53E-14 mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128516527 NA 3.12E-11 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128516527 2.11E-08 2.02E-20 mr1914_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128516527 8.74E-08 7.20E-23 mr1914_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128516527 NA 8.09E-18 mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128516527 NA 1.66E-18 mr1927_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251