\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128511488:

Variant ID: vg1128511488 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 28511488
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.87, G: 0.12, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


CGTATATGCTACTGTCACGCCGCGGCCACTGACGACATCTTCAGAAGTTTCCTGCCACTAGTGCTTTTACGGTACCCACTACTGTTAGTGGTAGCAGTGT[A/G]
GTACAACTTTAATCCAACCGTTGAATCTATTAACTTAACTAGCATGGTGGTCCATACAAATTACGCGACTAGCATTATTATATTTTCTCTCATATAATAG

Reverse complement sequence

CTATTATATGAGAGAAAATATAATAATGCTAGTCGCGTAATTTGTATGGACCACCATGCTAGTTAAGTTAATAGATTCAACGGTTGGATTAAAGTTGTAC[T/C]
ACACTGCTACCACTAACAGTAGTGGGTACCGTAAAAGCACTAGTGGCAGGAAACTTCTGAAGATGTCGTCAGTGGCCGCGGCGTGACAGTAGCATATACG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.60% 11.30% 0.95% 44.22% NA
All Indica  2759 36.80% 8.40% 1.12% 53.72% NA
All Japonica  1512 55.40% 14.70% 0.40% 29.56% NA
Aus  269 24.20% 24.50% 1.49% 49.81% NA
Indica I  595 62.50% 3.20% 0.67% 33.61% NA
Indica II  465 26.00% 1.30% 2.37% 70.32% NA
Indica III  913 25.50% 15.70% 0.55% 58.27% NA
Indica Intermediate  786 36.60% 8.10% 1.40% 53.82% NA
Temperate Japonica  767 57.10% 4.70% 0.52% 37.68% NA
Tropical Japonica  504 58.30% 26.80% 0.20% 14.68% NA
Japonica Intermediate  241 43.60% 21.20% 0.41% 34.85% NA
VI/Aromatic  96 93.80% 1.00% 0.00% 5.21% NA
Intermediate  90 58.90% 12.20% 4.44% 24.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1128511488 A -> DEL N N silent_mutation Average:81.257; most accessible tissue: Callus, score: 97.262 N N N N
vg1128511488 A -> G LOC_Os11g47390.1 upstream_gene_variant ; 325.0bp to feature; MODIFIER silent_mutation Average:81.257; most accessible tissue: Callus, score: 97.262 N N N N
vg1128511488 A -> G LOC_Os11g47400.1 upstream_gene_variant ; 4118.0bp to feature; MODIFIER silent_mutation Average:81.257; most accessible tissue: Callus, score: 97.262 N N N N
vg1128511488 A -> G LOC_Os11g47390-LOC_Os11g47400 intergenic_region ; MODIFIER silent_mutation Average:81.257; most accessible tissue: Callus, score: 97.262 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1128511488 A G -0.03 -0.01 0.0 0.01 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1128511488 NA 6.26E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511488 NA 1.78E-08 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511488 NA 8.03E-06 mr1186 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511488 NA 4.32E-06 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511488 NA 4.55E-06 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511488 NA 5.95E-06 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511488 3.89E-08 1.52E-12 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511488 2.15E-08 2.15E-08 mr1299 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511488 4.55E-06 NA mr1304 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511488 NA 3.27E-07 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511488 NA 8.03E-06 mr1339 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511488 5.52E-07 1.55E-10 mr1345 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511488 NA 6.02E-06 mr1345 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511488 NA 7.13E-06 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511488 NA 5.11E-06 mr1417 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511488 9.66E-09 2.94E-11 mr1427 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511488 7.39E-06 4.18E-07 mr1427 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511488 2.26E-06 NA mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511488 NA 3.40E-08 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511488 4.18E-06 4.17E-06 mr1605 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511488 NA 2.82E-07 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511488 4.59E-06 1.09E-08 mr1639 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511488 NA 3.42E-06 mr1661 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511488 2.20E-07 NA mr1700 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511488 4.56E-06 2.02E-08 mr1700 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511488 NA 7.10E-08 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511488 8.06E-06 1.42E-08 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511488 3.55E-06 3.55E-06 mr1756 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511488 NA 5.06E-06 mr1759 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511488 NA 2.29E-06 mr1820 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511488 2.76E-06 NA mr1846 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511488 NA 5.80E-07 mr1852 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511488 NA 7.04E-08 mr1852 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251