\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128511351:

Variant ID: vg1128511351 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 28511351
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGCTTGGAAAATAAAAAAATTCTTCCACGTTTCACGCATGTATTCTTCTACAGCAGTGGCACGACTACTAACGAAAAGTTTTTTCTCAAACTGGCGTTA[G/C]
TTGGTTGTCTGCGCGCTCGTGTCGTATATATGCATGCGTATATGCTACTGTCACGCCGCGGCCACTGACGACATCTTCAGAAGTTTCCTGCCACTAGTGC

Reverse complement sequence

GCACTAGTGGCAGGAAACTTCTGAAGATGTCGTCAGTGGCCGCGGCGTGACAGTAGCATATACGCATGCATATATACGACACGAGCGCGCAGACAACCAA[C/G]
TAACGCCAGTTTGAGAAAAAACTTTTCGTTAGTAGTCGTGCCACTGCTGTAGAAGAATACATGCGTGAAACGTGGAAGAATTTTTTTATTTTCCAAGCTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 48.50% 5.90% 0.74% 44.86% NA
All Indica  2759 44.20% 0.40% 0.87% 54.51% NA
All Japonica  1512 57.00% 13.00% 0.26% 29.70% NA
Aus  269 23.80% 23.00% 1.49% 51.67% NA
Indica I  595 64.00% 0.30% 0.67% 34.96% NA
Indica II  465 26.00% 0.20% 1.94% 71.83% NA
Indica III  913 41.40% 0.00% 0.33% 58.27% NA
Indica Intermediate  786 43.30% 1.00% 1.02% 54.71% NA
Temperate Japonica  767 57.10% 4.80% 0.39% 37.68% NA
Tropical Japonica  504 61.70% 23.40% 0.00% 14.88% NA
Japonica Intermediate  241 46.90% 17.40% 0.41% 35.27% NA
VI/Aromatic  96 92.70% 1.00% 1.04% 5.21% NA
Intermediate  90 64.40% 7.80% 2.22% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1128511351 G -> DEL N N silent_mutation Average:84.264; most accessible tissue: Callus, score: 95.312 N N N N
vg1128511351 G -> C LOC_Os11g47390.1 upstream_gene_variant ; 188.0bp to feature; MODIFIER silent_mutation Average:84.264; most accessible tissue: Callus, score: 95.312 N N N N
vg1128511351 G -> C LOC_Os11g47400.1 upstream_gene_variant ; 4255.0bp to feature; MODIFIER silent_mutation Average:84.264; most accessible tissue: Callus, score: 95.312 N N N N
vg1128511351 G -> C LOC_Os11g47390-LOC_Os11g47400 intergenic_region ; MODIFIER silent_mutation Average:84.264; most accessible tissue: Callus, score: 95.312 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1128511351 G C -0.06 0.0 0.0 0.01 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1128511351 NA 4.72E-06 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511351 NA 7.57E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511351 NA 2.38E-08 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511351 NA 9.67E-06 mr1227 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511351 2.73E-08 1.10E-13 mr1299 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511351 1.48E-07 1.48E-07 mr1299 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511351 NA 8.40E-07 mr1304 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511351 8.79E-06 1.61E-09 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511351 1.65E-08 6.92E-11 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511351 NA 2.69E-06 mr1427 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511351 1.51E-06 NA mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511351 NA 9.36E-08 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511351 7.47E-06 7.46E-06 mr1605 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511351 NA 1.57E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511351 8.54E-06 3.05E-08 mr1639 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511351 NA 4.64E-06 mr1661 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511351 3.74E-06 NA mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511351 NA 2.38E-07 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511351 NA 7.52E-07 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511351 9.10E-06 4.76E-09 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511351 NA 2.24E-07 mr1852 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128511351 NA 7.11E-06 mr1876 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251