Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128504558:

Variant ID: vg1128504558 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 28504558
Reference Allele: G	Alternative Allele: A,C
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CATGTGTTGGGACGAGGCACATGTGTTGGGCAGTTGCGGAGTGCGGGTAAAGTGTACATCCACTGCAGTGTGAGTAAACCAAATCTATTCGAATAGCCGT[G/A,C]
CTCGCGGTTATTGAGCACCGGGACATGTATTACACTTGGCTAGATTCTAGATTCTTAACTTGTGTGGGATGGGATATTGCATGATGATTTTTATGCTGTT

Reverse complement sequence

AACAGCATAAAAATCATCATGCAATATCCCATCCCACACAAGTTAAGAATCTAGAATCTAGCCAAGTGTAATACATGTCCCGGTGCTCAATAACCGCGAG[C/T,G]
ACGGCTATTCGAATAGATTTGGTTTACTCACACTGCAGTGGATGTACACTTTACCCGCACTCCGCAACTGCCCAACACATGTGCCTCGTCCCAACACATG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	62.60%	5.50%	2.81%	29.05%	C: 0.02%
All Indica	2759	62.10%	0.50%	3.37%	34.00%	C: 0.04%
All Japonica	1512	61.60%	11.60%	1.98%	24.80%	NA
Aus	269	60.20%	22.70%	3.35%	13.75%	NA
Indica I	595	71.60%	0.30%	2.35%	25.71%	NA
Indica II	465	49.50%	0.20%	7.31%	43.01%	NA
Indica III	913	60.70%	0.20%	2.85%	36.14%	C: 0.11%
Indica Intermediate	786	64.10%	1.00%	2.42%	32.44%	NA
Temperate Japonica	767	61.40%	2.30%	2.74%	33.51%	NA
Tropical Japonica	504	65.30%	23.20%	0.79%	10.71%	NA
Japonica Intermediate	241	54.40%	17.00%	2.07%	26.56%	NA
VI/Aromatic	96	94.80%	1.00%	1.04%	3.12%	NA
Intermediate	90	68.90%	8.90%	0.00%	22.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1128504558	G -> A	LOC_Os11g47370.1	downstream_gene_variant ; 4400.0bp to feature; MODIFIER	silent_mutation	Average:49.737; most accessible tissue: Zhenshan97 flag leaf, score: 66.824	N	N	N	N
vg1128504558	G -> A	LOC_Os11g47390.1	downstream_gene_variant ; 3886.0bp to feature; MODIFIER	silent_mutation	Average:49.737; most accessible tissue: Zhenshan97 flag leaf, score: 66.824	N	N	N	N
vg1128504558	G -> A	LOC_Os11g47370-LOC_Os11g47390	intergenic_region ; MODIFIER	silent_mutation	Average:49.737; most accessible tissue: Zhenshan97 flag leaf, score: 66.824	N	N	N	N
vg1128504558	G -> DEL	N	N	silent_mutation	Average:49.737; most accessible tissue: Zhenshan97 flag leaf, score: 66.824	N	N	N	N
vg1128504558	G -> C	LOC_Os11g47370.1	downstream_gene_variant ; 4400.0bp to feature; MODIFIER	silent_mutation	Average:49.737; most accessible tissue: Zhenshan97 flag leaf, score: 66.824	N	N	N	N
vg1128504558	G -> C	LOC_Os11g47390.1	downstream_gene_variant ; 3886.0bp to feature; MODIFIER	silent_mutation	Average:49.737; most accessible tissue: Zhenshan97 flag leaf, score: 66.824	N	N	N	N
vg1128504558	G -> C	LOC_Os11g47370-LOC_Os11g47390	intergenic_region ; MODIFIER	silent_mutation	Average:49.737; most accessible tissue: Zhenshan97 flag leaf, score: 66.824	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1128504558	7.18E-06	7.18E-06	mr1041	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558	NA	9.01E-06	mr1044	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558	NA	3.02E-06	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558	NA	2.90E-06	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558	8.67E-06	NA	mr1083	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558	3.00E-06	7.26E-10	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558	1.62E-06	1.62E-06	mr1145	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558	NA	1.12E-06	mr1159	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558	NA	3.08E-07	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558	7.49E-07	1.05E-11	mr1299	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558	2.61E-06	2.60E-06	mr1299	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558	9.27E-06	3.69E-10	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558	NA	1.63E-06	mr1408	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558	4.63E-07	9.23E-10	mr1427	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558	5.64E-06	NA	mr1560	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558	NA	6.57E-08	mr1560	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558	NA	8.75E-06	mr1632	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558	NA	3.39E-06	mr1634	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558	NA	5.31E-08	mr1639	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558	NA	6.29E-08	mr1648	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558	NA	3.23E-06	mr1665	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558	NA	6.87E-07	mr1700	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558	NA	1.51E-08	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558	5.41E-06	5.42E-06	mr1823	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558	NA	5.93E-07	mr1852	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558	NA	1.59E-06	mr1876	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558	NA	5.52E-06	mr1082_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558	NA	4.69E-06	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251