\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128504558:

Variant ID: vg1128504558 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 28504558
Reference Allele: GAlternative Allele: A,C
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATGTGTTGGGACGAGGCACATGTGTTGGGCAGTTGCGGAGTGCGGGTAAAGTGTACATCCACTGCAGTGTGAGTAAACCAAATCTATTCGAATAGCCGT[G/A,C]
CTCGCGGTTATTGAGCACCGGGACATGTATTACACTTGGCTAGATTCTAGATTCTTAACTTGTGTGGGATGGGATATTGCATGATGATTTTTATGCTGTT

Reverse complement sequence

AACAGCATAAAAATCATCATGCAATATCCCATCCCACACAAGTTAAGAATCTAGAATCTAGCCAAGTGTAATACATGTCCCGGTGCTCAATAACCGCGAG[C/T,G]
ACGGCTATTCGAATAGATTTGGTTTACTCACACTGCAGTGGATGTACACTTTACCCGCACTCCGCAACTGCCCAACACATGTGCCTCGTCCCAACACATG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.60% 5.50% 2.81% 29.05% C: 0.02%
All Indica  2759 62.10% 0.50% 3.37% 34.00% C: 0.04%
All Japonica  1512 61.60% 11.60% 1.98% 24.80% NA
Aus  269 60.20% 22.70% 3.35% 13.75% NA
Indica I  595 71.60% 0.30% 2.35% 25.71% NA
Indica II  465 49.50% 0.20% 7.31% 43.01% NA
Indica III  913 60.70% 0.20% 2.85% 36.14% C: 0.11%
Indica Intermediate  786 64.10% 1.00% 2.42% 32.44% NA
Temperate Japonica  767 61.40% 2.30% 2.74% 33.51% NA
Tropical Japonica  504 65.30% 23.20% 0.79% 10.71% NA
Japonica Intermediate  241 54.40% 17.00% 2.07% 26.56% NA
VI/Aromatic  96 94.80% 1.00% 1.04% 3.12% NA
Intermediate  90 68.90% 8.90% 0.00% 22.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1128504558 G -> A LOC_Os11g47370.1 downstream_gene_variant ; 4400.0bp to feature; MODIFIER silent_mutation Average:49.737; most accessible tissue: Zhenshan97 flag leaf, score: 66.824 N N N N
vg1128504558 G -> A LOC_Os11g47390.1 downstream_gene_variant ; 3886.0bp to feature; MODIFIER silent_mutation Average:49.737; most accessible tissue: Zhenshan97 flag leaf, score: 66.824 N N N N
vg1128504558 G -> A LOC_Os11g47370-LOC_Os11g47390 intergenic_region ; MODIFIER silent_mutation Average:49.737; most accessible tissue: Zhenshan97 flag leaf, score: 66.824 N N N N
vg1128504558 G -> DEL N N silent_mutation Average:49.737; most accessible tissue: Zhenshan97 flag leaf, score: 66.824 N N N N
vg1128504558 G -> C LOC_Os11g47370.1 downstream_gene_variant ; 4400.0bp to feature; MODIFIER silent_mutation Average:49.737; most accessible tissue: Zhenshan97 flag leaf, score: 66.824 N N N N
vg1128504558 G -> C LOC_Os11g47390.1 downstream_gene_variant ; 3886.0bp to feature; MODIFIER silent_mutation Average:49.737; most accessible tissue: Zhenshan97 flag leaf, score: 66.824 N N N N
vg1128504558 G -> C LOC_Os11g47370-LOC_Os11g47390 intergenic_region ; MODIFIER silent_mutation Average:49.737; most accessible tissue: Zhenshan97 flag leaf, score: 66.824 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1128504558 7.18E-06 7.18E-06 mr1041 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558 NA 9.01E-06 mr1044 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558 NA 3.02E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558 NA 2.90E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558 8.67E-06 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558 3.00E-06 7.26E-10 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558 1.62E-06 1.62E-06 mr1145 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558 NA 1.12E-06 mr1159 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558 NA 3.08E-07 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558 7.49E-07 1.05E-11 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558 2.61E-06 2.60E-06 mr1299 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558 9.27E-06 3.69E-10 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558 NA 1.63E-06 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558 4.63E-07 9.23E-10 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558 5.64E-06 NA mr1560 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558 NA 6.57E-08 mr1560 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558 NA 8.75E-06 mr1632 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558 NA 3.39E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558 NA 5.31E-08 mr1639 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558 NA 6.29E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558 NA 3.23E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558 NA 6.87E-07 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558 NA 1.51E-08 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558 5.41E-06 5.42E-06 mr1823 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558 NA 5.93E-07 mr1852 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558 NA 1.59E-06 mr1876 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558 NA 5.52E-06 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128504558 NA 4.69E-06 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251