\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128437977:

Variant ID: vg1128437977 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 28437977
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGACTGTTGGGAATCAAGCCACTGAGATAGTTCCTACGGAGATTCATACTGCCAAGGCTTCGCAGGCCCTGCAGCTCTGCTGGGATTGGACCAGATAGC[T/C]
GGTTAAACTCGAGATTAAGAAGCTCAAGTTTGGTGAGGTTTCCTATGGTGGCTGGGATGTTACCTGACAGGGCATTGTAGCCAAGATCAAGGAGCTCCAG

Reverse complement sequence

CTGGAGCTCCTTGATCTTGGCTACAATGCCCTGTCAGGTAACATCCCAGCCACCATAGGAAACCTCACCAAACTTGAGCTTCTTAATCTCGAGTTTAACC[A/G]
GCTATCTGGTCCAATCCCAGCAGAGCTGCAGGGCCTGCGAAGCCTTGGCAGTATGAATCTCCGTAGGAACTATCTCAGTGGCTTGATTCCCAACAGTCTA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.20% 18.50% 0.30% 1.02% NA
All Indica  2759 94.10% 4.50% 0.25% 1.20% NA
All Japonica  1512 62.40% 36.20% 0.40% 0.99% NA
Aus  269 55.00% 44.60% 0.37% 0.00% NA
Indica I  595 97.80% 1.80% 0.34% 0.00% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 91.30% 5.50% 0.22% 2.96% NA
Indica Intermediate  786 92.90% 6.00% 0.38% 0.76% NA
Temperate Japonica  767 81.40% 17.90% 0.78% 0.00% NA
Tropical Japonica  504 38.50% 59.70% 0.00% 1.79% NA
Japonica Intermediate  241 52.30% 45.20% 0.00% 2.49% NA
VI/Aromatic  96 38.50% 61.50% 0.00% 0.00% NA
Intermediate  90 74.40% 25.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1128437977 T -> DEL LOC_Os11g47290.1 N frameshift_variant Average:81.237; most accessible tissue: Minghui63 root, score: 87.964 N N N N
vg1128437977 T -> C LOC_Os11g47290.1 missense_variant ; p.Gln164Arg; MODERATE nonsynonymous_codon ; Q164R Average:81.237; most accessible tissue: Minghui63 root, score: 87.964 benign 0.443 TOLERATED 0.15

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1128437977 T C -0.01 0.0 0.0 0.0 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1128437977 1.44E-07 NA mr1238 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128437977 NA 1.91E-06 mr1238 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128437977 7.71E-08 NA mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128437977 NA 1.39E-07 mr1309 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128437977 9.73E-08 NA mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128437977 5.00E-06 4.47E-08 mr1484 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128437977 6.68E-07 NA mr1841 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128437977 NA 4.25E-06 mr1841 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128437977 6.59E-06 NA mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128437977 NA 2.84E-06 mr1900 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128437977 7.07E-08 NA mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128437977 NA 9.02E-08 mr1238_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128437977 1.21E-06 NA mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128437977 7.87E-07 7.87E-07 mr1484_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128437977 1.19E-08 NA mr1841_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128437977 NA 8.74E-09 mr1841_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128437977 1.95E-07 NA mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128437977 NA 1.83E-07 mr1900_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251