\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128432615:

Variant ID: vg1128432615 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 28432615
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATTTATAAACTTTGGGTCTCTAAACTTTGGGTCTATAAACTTTAGGTGTATAAACTTTAGGTGCATAAATTTTACTAAAATAGAAAAGTAATGCGGTGC[C/T]
AGAAAAGGAAACGTGGAAGGAGGGAGGGGGGAGGGGATGCGATCGCTACCAGATCGCGGTAGCGATTGATCGCCCATTAGATTTTCCGCCCATAAGTACG

Reverse complement sequence

CGTACTTATGGGCGGAAAATCTAATGGGCGATCAATCGCTACCGCGATCTGGTAGCGATCGCATCCCCTCCCCCCTCCCTCCTTCCACGTTTCCTTTTCT[G/A]
GCACCGCATTACTTTTCTATTTTAGTAAAATTTATGCACCTAAAGTTTATACACCTAAAGTTTATAGACCCAAAGTTTAGAGACCCAAAGTTTATAAATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.70% 6.00% 3.96% 49.39% NA
All Indica  2759 35.20% 4.60% 4.02% 56.18% NA
All Japonica  1512 53.10% 9.10% 2.58% 35.19% NA
Aus  269 25.30% 0.40% 11.52% 62.83% NA
Indica I  595 60.80% 0.50% 4.20% 34.45% NA
Indica II  465 11.80% 17.80% 4.73% 65.59% NA
Indica III  913 33.80% 0.20% 2.96% 62.98% NA
Indica Intermediate  786 31.20% 5.00% 4.71% 59.16% NA
Temperate Japonica  767 63.40% 0.30% 1.30% 35.07% NA
Tropical Japonica  504 36.30% 22.20% 3.57% 37.90% NA
Japonica Intermediate  241 55.60% 10.00% 4.56% 29.88% NA
VI/Aromatic  96 37.50% 7.30% 1.04% 54.17% NA
Intermediate  90 48.90% 11.10% 5.56% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1128432615 C -> T LOC_Os11g47269.1 downstream_gene_variant ; 3490.0bp to feature; MODIFIER silent_mutation Average:11.794; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg1128432615 C -> T LOC_Os11g47278.1 downstream_gene_variant ; 1826.0bp to feature; MODIFIER silent_mutation Average:11.794; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg1128432615 C -> T LOC_Os11g47290.1 intron_variant ; MODIFIER silent_mutation Average:11.794; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N
vg1128432615 C -> DEL N N silent_mutation Average:11.794; most accessible tissue: Minghui63 panicle, score: 20.733 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1128432615 NA 5.60E-08 mr1115_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128432615 NA 7.00E-06 mr1193_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128432615 NA 8.76E-11 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128432615 NA 5.38E-07 mr1588_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128432615 4.32E-07 4.56E-12 mr1828_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251