\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128246741:

Variant ID: vg1128246741 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 28246741
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.01, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


TGTGATGTCTTTATTTTCCAGCGTTTACCTAGTAGTGCTGTCAAATATTTATGACCGGAAGGAGTATCATTTAAGTTTCTTTCGCTTTCTGAGAGCAACA[G/A]
TCAAGGTCGTCCTACATGTCGAAAGCAAACTAGCACTACTGTGCTAAATAAAGCTCAACTTGATCGTCACTGTGAAGTATGATGCATACTCTTGCTGCCA

Reverse complement sequence

TGGCAGCAAGAGTATGCATCATACTTCACAGTGACGATCAAGTTGAGCTTTATTTAGCACAGTAGTGCTAGTTTGCTTTCGACATGTAGGACGACCTTGA[C/T]
TGTTGCTCTCAGAAAGCGAAAGAAACTTAAATGATACTCCTTCCGGTCATAAATATTTGACAGCACTACTAGGTAAACGCTGGAAAATAAAGACATCACA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 67.30% 4.80% 2.54% 25.33% NA
All Indica  2759 76.50% 4.30% 1.52% 17.69% NA
All Japonica  1512 57.40% 0.60% 4.70% 37.30% NA
Aus  269 37.90% 14.50% 2.23% 45.35% NA
Indica I  595 71.60% 1.70% 1.68% 25.04% NA
Indica II  465 93.30% 0.40% 0.00% 6.24% NA
Indica III  913 75.80% 5.80% 1.86% 16.54% NA
Indica Intermediate  786 71.00% 6.90% 1.91% 20.23% NA
Temperate Japonica  767 70.00% 0.70% 4.95% 24.38% NA
Tropical Japonica  504 39.70% 0.60% 3.97% 55.75% NA
Japonica Intermediate  241 54.40% 0.40% 5.39% 39.83% NA
VI/Aromatic  96 37.50% 56.20% 0.00% 6.25% NA
Intermediate  90 72.20% 7.80% 1.11% 18.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1128246741 G -> A LOC_Os11g46990.1 upstream_gene_variant ; 4195.0bp to feature; MODIFIER silent_mutation Average:70.012; most accessible tissue: Zhenshan97 flag leaf, score: 93.807 N N N N
vg1128246741 G -> A LOC_Os11g47000.1 upstream_gene_variant ; 122.0bp to feature; MODIFIER silent_mutation Average:70.012; most accessible tissue: Zhenshan97 flag leaf, score: 93.807 N N N N
vg1128246741 G -> A LOC_Os11g47010.1 upstream_gene_variant ; 4381.0bp to feature; MODIFIER silent_mutation Average:70.012; most accessible tissue: Zhenshan97 flag leaf, score: 93.807 N N N N
vg1128246741 G -> A LOC_Os11g46990-LOC_Os11g47000 intergenic_region ; MODIFIER silent_mutation Average:70.012; most accessible tissue: Zhenshan97 flag leaf, score: 93.807 N N N N
vg1128246741 G -> DEL N N silent_mutation Average:70.012; most accessible tissue: Zhenshan97 flag leaf, score: 93.807 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1128246741 G A -0.19 -0.24 -0.29 -0.07 -0.15 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1128246741 3.04E-08 9.14E-07 mr1622_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251