\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128170551:

Variant ID: vg1128170551 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 28170551
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


ATTTAGCTTTTACTTGTTGACGTTACAAAATCTTTATATTTTCAACTATATGTAAATTCACCCAGCAATCCTCAACCGTATAATACCTCAACAATGTTGG[T/C]
TTGTTTCGATCGTGCACTTCGAAACAAGCCAACATTACAAGAGTCAAGTCAATGTTCGTATGTACATGTATCACATTAGTAAGAACATACTAATTTGGCT

Reverse complement sequence

AGCCAAATTAGTATGTTCTTACTAATGTGATACATGTACATACGAACATTGACTTGACTCTTGTAATGTTGGCTTGTTTCGAAGTGCACGATCGAAACAA[A/G]
CCAACATTGTTGAGGTATTATACGGTTGAGGATTGCTGGGTGAATTTACATATAGTTGAAAATATAAAGATTTTGTAACGTCAACAAGTAAAAGCTAAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.60% 1.50% 0.13% 9.75% NA
All Indica  2759 94.80% 0.90% 0.00% 4.28% NA
All Japonica  1512 82.40% 1.40% 0.33% 15.87% NA
Aus  269 63.20% 4.80% 0.37% 31.60% NA
Indica I  595 98.70% 0.20% 0.00% 1.18% NA
Indica II  465 96.10% 0.00% 0.00% 3.87% NA
Indica III  913 92.80% 0.80% 0.00% 6.46% NA
Indica Intermediate  786 93.50% 2.20% 0.00% 4.33% NA
Temperate Japonica  767 94.50% 0.70% 0.13% 4.69% NA
Tropical Japonica  504 67.90% 1.40% 0.60% 30.16% NA
Japonica Intermediate  241 74.30% 3.70% 0.41% 21.58% NA
VI/Aromatic  96 79.20% 12.50% 0.00% 8.33% NA
Intermediate  90 86.70% 2.20% 0.00% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1128170551 T -> DEL N N silent_mutation Average:23.444; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 N N N N
vg1128170551 T -> C LOC_Os11g46900.1 upstream_gene_variant ; 4430.0bp to feature; MODIFIER silent_mutation Average:23.444; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 N N N N
vg1128170551 T -> C LOC_Os11g46890.1 downstream_gene_variant ; 1838.0bp to feature; MODIFIER silent_mutation Average:23.444; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 N N N N
vg1128170551 T -> C LOC_Os11g46880-LOC_Os11g46890 intergenic_region ; MODIFIER silent_mutation Average:23.444; most accessible tissue: Zhenshan97 flag leaf, score: 64.768 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1128170551 2.85E-08 NA mr1745 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128170551 NA 7.13E-06 mr1745 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251