Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128170551:

Variant ID: vg1128170551 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 28170551
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

ATTTAGCTTTTACTTGTTGACGTTACAAAATCTTTATATTTTCAACTATATGTAAATTCACCCAGCAATCCTCAACCGTATAATACCTCAACAATGTTGG[T/C]
TTGTTTCGATCGTGCACTTCGAAACAAGCCAACATTACAAGAGTCAAGTCAATGTTCGTATGTACATGTATCACATTAGTAAGAACATACTAATTTGGCT

Reverse complement sequence

AGCCAAATTAGTATGTTCTTACTAATGTGATACATGTACATACGAACATTGACTTGACTCTTGTAATGTTGGCTTGTTTCGAAGTGCACGATCGAAACAA[A/G]
CCAACATTGTTGAGGTATTATACGGTTGAGGATTGCTGGGTGAATTTACATATAGTTGAAAATATAAAGATTTTGTAACGTCAACAAGTAAAAGCTAAAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.60%	1.50%	0.13%	9.75%	NA
All Indica	2759	94.80%	0.90%	0.00%	4.28%	NA
All Japonica	1512	82.40%	1.40%	0.33%	15.87%	NA
Aus	269	63.20%	4.80%	0.37%	31.60%	NA
Indica I	595	98.70%	0.20%	0.00%	1.18%	NA
Indica II	465	96.10%	0.00%	0.00%	3.87%	NA
Indica III	913	92.80%	0.80%	0.00%	6.46%	NA
Indica Intermediate	786	93.50%	2.20%	0.00%	4.33%	NA
Temperate Japonica	767	94.50%	0.70%	0.13%	4.69%	NA
Tropical Japonica	504	67.90%	1.40%	0.60%	30.16%	NA
Japonica Intermediate	241	74.30%	3.70%	0.41%	21.58%	NA
VI/Aromatic	96	79.20%	12.50%	0.00%	8.33%	NA
Intermediate	90	86.70%	2.20%	0.00%	11.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1128170551	T -> DEL	N	N	silent_mutation	Average:23.444; most accessible tissue: Zhenshan97 flag leaf, score: 64.768	N	N	N	N
vg1128170551	T -> C	LOC_Os11g46900.1	upstream_gene_variant ; 4430.0bp to feature; MODIFIER	silent_mutation	Average:23.444; most accessible tissue: Zhenshan97 flag leaf, score: 64.768	N	N	N	N
vg1128170551	T -> C	LOC_Os11g46890.1	downstream_gene_variant ; 1838.0bp to feature; MODIFIER	silent_mutation	Average:23.444; most accessible tissue: Zhenshan97 flag leaf, score: 64.768	N	N	N	N
vg1128170551	T -> C	LOC_Os11g46880-LOC_Os11g46890	intergenic_region ; MODIFIER	silent_mutation	Average:23.444; most accessible tissue: Zhenshan97 flag leaf, score: 64.768	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1128170551	2.85E-08	NA	mr1745	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128170551	NA	7.13E-06	mr1745	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251