Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128168473:

Variant ID: vg1128168473 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 28168473
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGACACGAAAACTTATGGCTGCACTTAAAATGGGACAGAGGGAGTACCTAAATTTTGGTTTCGCCACTGTTAGGAGTGATGTCCACTCAACTACTCCCTC[C/T]
GTCCCTAAATATAAGGGATTTTAGTTTAATGTGATACATCCTAGTACAACGAATTCGGGCATTAACCAAAATCTTTTATATTTAGGGACGGAGGGAGTAC

Reverse complement sequence

GTACTCCCTCCGTCCCTAAATATAAAAGATTTTGGTTAATGCCCGAATTCGTTGTACTAGGATGTATCACATTAAACTAAAATCCCTTATATTTAGGGAC[G/A]
GAGGGAGTAGTTGAGTGGACATCACTCCTAACAGTGGCGAAACCAAAATTTAGGTACTCCCTCTGTCCCATTTTAAGTGCAGCCATAAGTTTTCGTGTCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.90%	6.40%	0.70%	11.00%	NA
All Indica	2759	83.80%	10.60%	0.87%	4.75%	NA
All Japonica	1512	81.30%	0.30%	0.26%	18.19%	NA
Aus	269	62.80%	0.40%	1.49%	35.32%	NA
Indica I	595	98.80%	0.00%	0.00%	1.18%	NA
Indica II	465	66.70%	26.90%	2.37%	4.09%	NA
Indica III	913	86.00%	6.70%	0.22%	7.12%	NA
Indica Intermediate	786	79.90%	13.60%	1.40%	5.09%	NA
Temperate Japonica	767	94.40%	0.30%	0.00%	5.35%	NA
Tropical Japonica	504	66.10%	0.20%	0.60%	33.13%	NA
Japonica Intermediate	241	71.40%	0.40%	0.41%	27.80%	NA
VI/Aromatic	96	89.60%	2.10%	0.00%	8.33%	NA
Intermediate	90	82.20%	4.40%	1.11%	12.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1128168473	C -> T	LOC_Os11g46880.1	downstream_gene_variant ; 3172.0bp to feature; MODIFIER	silent_mutation	Average:40.225; most accessible tissue: Zhenshan97 flag leaf, score: 89.283	N	N	N	N
vg1128168473	C -> T	LOC_Os11g46890.1	downstream_gene_variant ; 3916.0bp to feature; MODIFIER	silent_mutation	Average:40.225; most accessible tissue: Zhenshan97 flag leaf, score: 89.283	N	N	N	N
vg1128168473	C -> T	LOC_Os11g46880-LOC_Os11g46890	intergenic_region ; MODIFIER	silent_mutation	Average:40.225; most accessible tissue: Zhenshan97 flag leaf, score: 89.283	N	N	N	N
vg1128168473	C -> DEL	N	N	silent_mutation	Average:40.225; most accessible tissue: Zhenshan97 flag leaf, score: 89.283	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1128168473	6.54E-06	5.67E-07	mr1113	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128168473	5.60E-06	1.69E-06	mr1238	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128168473	NA	9.69E-06	mr1309	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128168473	NA	6.50E-06	mr1113_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128168473	NA	1.27E-06	mr1114_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128168473	1.67E-07	3.55E-07	mr1238_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128168473	6.72E-06	NA	mr1484_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128168473	5.93E-09	2.29E-07	mr1841_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128168473	5.31E-07	2.64E-06	mr1900_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251