\
| Variant ID: vg1128168473 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 28168473 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGACACGAAAACTTATGGCTGCACTTAAAATGGGACAGAGGGAGTACCTAAATTTTGGTTTCGCCACTGTTAGGAGTGATGTCCACTCAACTACTCCCTC[C/T]
GTCCCTAAATATAAGGGATTTTAGTTTAATGTGATACATCCTAGTACAACGAATTCGGGCATTAACCAAAATCTTTTATATTTAGGGACGGAGGGAGTAC
GTACTCCCTCCGTCCCTAAATATAAAAGATTTTGGTTAATGCCCGAATTCGTTGTACTAGGATGTATCACATTAAACTAAAATCCCTTATATTTAGGGAC[G/A]
GAGGGAGTAGTTGAGTGGACATCACTCCTAACAGTGGCGAAACCAAAATTTAGGTACTCCCTCTGTCCCATTTTAAGTGCAGCCATAAGTTTTCGTGTCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.90% | 6.40% | 0.70% | 11.00% | NA |
| All Indica | 2759 | 83.80% | 10.60% | 0.87% | 4.75% | NA |
| All Japonica | 1512 | 81.30% | 0.30% | 0.26% | 18.19% | NA |
| Aus | 269 | 62.80% | 0.40% | 1.49% | 35.32% | NA |
| Indica I | 595 | 98.80% | 0.00% | 0.00% | 1.18% | NA |
| Indica II | 465 | 66.70% | 26.90% | 2.37% | 4.09% | NA |
| Indica III | 913 | 86.00% | 6.70% | 0.22% | 7.12% | NA |
| Indica Intermediate | 786 | 79.90% | 13.60% | 1.40% | 5.09% | NA |
| Temperate Japonica | 767 | 94.40% | 0.30% | 0.00% | 5.35% | NA |
| Tropical Japonica | 504 | 66.10% | 0.20% | 0.60% | 33.13% | NA |
| Japonica Intermediate | 241 | 71.40% | 0.40% | 0.41% | 27.80% | NA |
| VI/Aromatic | 96 | 89.60% | 2.10% | 0.00% | 8.33% | NA |
| Intermediate | 90 | 82.20% | 4.40% | 1.11% | 12.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1128168473 | C -> T | LOC_Os11g46880.1 | downstream_gene_variant ; 3172.0bp to feature; MODIFIER | silent_mutation | Average:40.225; most accessible tissue: Zhenshan97 flag leaf, score: 89.283 | N | N | N | N |
| vg1128168473 | C -> T | LOC_Os11g46890.1 | downstream_gene_variant ; 3916.0bp to feature; MODIFIER | silent_mutation | Average:40.225; most accessible tissue: Zhenshan97 flag leaf, score: 89.283 | N | N | N | N |
| vg1128168473 | C -> T | LOC_Os11g46880-LOC_Os11g46890 | intergenic_region ; MODIFIER | silent_mutation | Average:40.225; most accessible tissue: Zhenshan97 flag leaf, score: 89.283 | N | N | N | N |
| vg1128168473 | C -> DEL | N | N | silent_mutation | Average:40.225; most accessible tissue: Zhenshan97 flag leaf, score: 89.283 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1128168473 | 6.54E-06 | 5.67E-07 | mr1113 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128168473 | 5.60E-06 | 1.69E-06 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128168473 | NA | 9.69E-06 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128168473 | NA | 6.50E-06 | mr1113_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128168473 | NA | 1.27E-06 | mr1114_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128168473 | 1.67E-07 | 3.55E-07 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128168473 | 6.72E-06 | NA | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128168473 | 5.93E-09 | 2.29E-07 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1128168473 | 5.31E-07 | 2.64E-06 | mr1900_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |