Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1128025024:

Variant ID: vg1128025024 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 28025024
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

GGGCGTCTGAGCATATCCAATATAACGGATAGTGCCTCGTTGAGGGAACGGATGTGTTCGCCTCACGGCGTTAGGATTAGGATGGGGCCCACCTTTCCTG[G/A]
CGGCATTGGTTCATGGCCAATGTGGAGAAACACTCTCCGTGCTCATGCAAGGCTAGACTTTAAGCAATGTAACAGCTTCGTAGAGTGTAGCCTTTTGGCT

Reverse complement sequence

AGCCAAAAGGCTACACTCTACGAAGCTGTTACATTGCTTAAAGTCTAGCCTTGCATGAGCACGGAGAGTGTTTCTCCACATTGGCCATGAACCAATGCCG[C/T]
CAGGAAAGGTGGGCCCCATCCTAATCCTAACGCCGTGAGGCGAACACATCCGTTCCCTCAACGAGGCACTATCCGTTATATTGGATATGCTCAGACGCCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	21.70%	1.50%	38.43%	38.38%	NA
All Indica	2759	12.50%	2.50%	60.53%	24.50%	NA
All Japonica	1512	27.80%	0.00%	2.58%	69.58%	NA
Aus	269	62.10%	0.00%	23.05%	14.87%	NA
Indica I	595	9.60%	2.40%	54.29%	33.78%	NA
Indica II	465	5.80%	2.40%	61.94%	29.89%	NA
Indica III	913	13.50%	2.80%	69.33%	14.35%	NA
Indica Intermediate	786	17.40%	2.30%	54.20%	26.08%	NA
Temperate Japonica	767	19.40%	0.00%	1.69%	78.88%	NA
Tropical Japonica	504	37.70%	0.00%	2.78%	59.52%	NA
Japonica Intermediate	241	34.00%	0.00%	4.98%	61.00%	NA
VI/Aromatic	96	60.40%	1.00%	20.83%	17.71%	NA
Intermediate	90	38.90%	1.10%	27.78%	32.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1128025024	G -> A	LOC_Os11g46280.1	upstream_gene_variant ; 1633.0bp to feature; MODIFIER	silent_mutation	Average:17.86; most accessible tissue: Minghui63 root, score: 27.443	N	N	N	N
vg1128025024	G -> A	LOC_Os11g46270.1	downstream_gene_variant ; 3255.0bp to feature; MODIFIER	silent_mutation	Average:17.86; most accessible tissue: Minghui63 root, score: 27.443	N	N	N	N
vg1128025024	G -> A	LOC_Os11g46290.1	downstream_gene_variant ; 1274.0bp to feature; MODIFIER	silent_mutation	Average:17.86; most accessible tissue: Minghui63 root, score: 27.443	N	N	N	N
vg1128025024	G -> A	LOC_Os11g46280-LOC_Os11g46290	intergenic_region ; MODIFIER	silent_mutation	Average:17.86; most accessible tissue: Minghui63 root, score: 27.443	N	N	N	N
vg1128025024	G -> DEL	N	N	silent_mutation	Average:17.86; most accessible tissue: Minghui63 root, score: 27.443	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1128025024	NA	2.95E-06	mr1027_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128025024	NA	6.53E-06	mr1057_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128025024	NA	7.52E-07	mr1063_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128025024	4.30E-06	4.30E-06	mr1171_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128025024	NA	2.08E-10	mr1215_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128025024	NA	3.08E-06	mr1422_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128025024	1.83E-06	3.89E-07	mr1442_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128025024	NA	2.74E-06	mr1580_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128025024	4.74E-06	NA	mr1790_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128025024	NA	2.26E-06	mr1790_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128025024	NA	2.88E-06	mr1825_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128025024	NA	3.54E-13	mr1850_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1128025024	NA	7.78E-08	mr1885_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251