\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127981469:

Variant ID: vg1127981469 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 27981469
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.65, C: 0.35, others allele: 0.00, population size: 78. )

Flanking Sequence (100 bp) in Reference Genome:


CAATCCAAGGATGCATATTGTTTTGACCTCGTGAAATTCACAAGGCTTCGTCGCCTCCTCTACCCTTTTTCTCTTATCCTCGACCTGCACCAACTGGGCG[C/T]
GGCCCACCTTATTCCGGAGGGTGGACAAGAGCTTGCGGATGTTCGCGCCTTCACCATCCAACCGCAACGTATCTCCACACAAACTTCCCGAACGCAATCG

Reverse complement sequence

CGATTGCGTTCGGGAAGTTTGTGTGGAGATACGTTGCGGTTGGATGGTGAAGGCGCGAACATCCGCAAGCTCTTGTCCACCCTCCGGAATAAGGTGGGCC[G/A]
CGCCCAGTTGGTGCAGGTCGAGGATAAGAGAAAAAGGGTAGAGGAGGCGACGAAGCCTTGTGAATTTCACGAGGTCAAAACAATATGCATCCTTGGATTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 40.50% 20.80% 0.76% 37.96% NA
All Indica  2759 38.10% 26.60% 0.69% 34.58% NA
All Japonica  1512 42.60% 10.70% 0.86% 45.83% NA
Aus  269 59.90% 17.50% 1.49% 21.19% NA
Indica I  595 25.70% 33.10% 0.34% 40.84% NA
Indica II  465 15.70% 32.90% 0.86% 50.54% NA
Indica III  913 58.20% 19.30% 0.22% 22.34% NA
Indica Intermediate  786 37.50% 26.50% 1.40% 34.61% NA
Temperate Japonica  767 32.70% 15.60% 1.56% 50.07% NA
Tropical Japonica  504 56.90% 4.00% 0.00% 39.09% NA
Japonica Intermediate  241 44.00% 9.10% 0.41% 46.47% NA
VI/Aromatic  96 13.50% 26.00% 0.00% 60.42% NA
Intermediate  90 48.90% 15.60% 0.00% 35.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127981469 C -> T LOC_Os11g46200.1 missense_variant ; p.Arg261His; MODERATE nonsynonymous_codon ; R261H Average:51.84; most accessible tissue: Callus, score: 97.285 unknown unknown TOLERATED 0.64
vg1127981469 C -> DEL LOC_Os11g46200.1 N frameshift_variant Average:51.84; most accessible tissue: Callus, score: 97.285 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1127981469 C T -0.01 0.1 0.09 0.02 0.04 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127981469 3.41E-07 NA mr1166 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127981469 NA 1.03E-07 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127981469 NA 7.73E-06 mr1297 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127981469 NA 7.16E-08 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127981469 NA 6.25E-08 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127981469 1.55E-06 NA mr1515 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127981469 NA 1.21E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127981469 NA 5.50E-06 mr1640 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127981469 NA 1.01E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127981469 NA 9.50E-07 mr1724 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127981469 NA 4.65E-06 mr1777 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127981469 NA 5.65E-06 mr1976 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127981469 NA 2.90E-06 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251