\
| Variant ID: vg1127978095 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 27978095 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.96, T: 0.05, others allele: 0.00, population size: 89. )
TTTTTTAAGCGTGACACAAATAATCAAGCGGATAAACTTTTCGGAAGAGTGACAAGTATAATATGTTTAAGATAAATTAAATGCAGTCATTAGTTTCGAA[T/C]
GGGTCTTATTAAGTTTGGGAGTAGGTGAATTTTGGAGCGTGGCACTATAAATGAAACGAAAAGGTACACCCTATCCAACATAAAGTACAATTTAATTTCT
AGAAATTAAATTGTACTTTATGTTGGATAGGGTGTACCTTTTCGTTTCATTTATAGTGCCACGCTCCAAAATTCACCTACTCCCAAACTTAATAAGACCC[A/G]
TTCGAAACTAATGACTGCATTTAATTTATCTTAAACATATTATACTTGTCACTCTTCCGAAAAGTTTATCCGCTTGATTATTTGTGTCACGCTTAAAAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 26.10% | 25.80% | 0.89% | 47.27% | NA |
| All Indica | 2759 | 17.50% | 33.00% | 0.76% | 48.75% | NA |
| All Japonica | 1512 | 38.00% | 13.80% | 1.06% | 47.22% | NA |
| Aus | 269 | 47.20% | 23.00% | 1.12% | 28.62% | NA |
| Indica I | 595 | 15.10% | 43.00% | 0.84% | 41.01% | NA |
| Indica II | 465 | 12.90% | 3.40% | 0.43% | 83.23% | NA |
| Indica III | 913 | 17.90% | 48.70% | 0.66% | 32.75% | NA |
| Indica Intermediate | 786 | 21.60% | 24.60% | 1.02% | 52.80% | NA |
| Temperate Japonica | 767 | 27.20% | 19.70% | 0.78% | 52.28% | NA |
| Tropical Japonica | 504 | 53.00% | 6.00% | 1.39% | 39.68% | NA |
| Japonica Intermediate | 241 | 40.70% | 11.20% | 1.24% | 46.89% | NA |
| VI/Aromatic | 96 | 8.30% | 26.00% | 0.00% | 65.62% | NA |
| Intermediate | 90 | 45.60% | 13.30% | 2.22% | 38.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1127978095 | T -> DEL | N | N | silent_mutation | Average:22.67; most accessible tissue: Callus, score: 65.82 | N | N | N | N |
| vg1127978095 | T -> C | LOC_Os11g46190.1 | upstream_gene_variant ; 3260.0bp to feature; MODIFIER | silent_mutation | Average:22.67; most accessible tissue: Callus, score: 65.82 | N | N | N | N |
| vg1127978095 | T -> C | LOC_Os11g46200.1 | downstream_gene_variant ; 273.0bp to feature; MODIFIER | silent_mutation | Average:22.67; most accessible tissue: Callus, score: 65.82 | N | N | N | N |
| vg1127978095 | T -> C | LOC_Os11g46190-LOC_Os11g46200 | intergenic_region ; MODIFIER | silent_mutation | Average:22.67; most accessible tissue: Callus, score: 65.82 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1127978095 | NA | 3.00E-07 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127978095 | NA | 7.97E-06 | mr1159 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127978095 | 1.91E-06 | NA | mr1174 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127978095 | NA | 6.56E-09 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127978095 | NA | 2.46E-06 | mr1345 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127978095 | NA | 1.49E-06 | mr1427 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127978095 | NA | 5.09E-06 | mr1560 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127978095 | NA | 3.11E-06 | mr1634 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |