\
| Variant ID: vg1127963105 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 27963105 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.88, G: 0.12, others allele: 0.00, population size: 49. )
TATTGCATTTATTTTCGAATGTCATTGGGTGAAATTAACCTATTGTTTGCTAAAGCCCTTTTGTTCTTGATTACTTTATTCCTTGATACCTTGGGTTAAT[G/A]
TAACTTGACTAGTTGAACTTTATATATATTGGTTCAACTAGAATTTATATATGATTGCTTAGCCCTGCTTAGAAACATTAGCACACTATTGGGATAACTT
AAGTTATCCCAATAGTGTGCTAATGTTTCTAAGCAGGGCTAAGCAATCATATATAAATTCTAGTTGAACCAATATATATAAAGTTCAACTAGTCAAGTTA[C/T]
ATTAACCCAAGGTATCAAGGAATAAAGTAATCAAGAACAAAAGGGCTTTAGCAAACAATAGGTTAATTTCACCCAATGACATTCGAAAATAAATGCAATA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 46.00% | 26.40% | 10.66% | 16.89% | NA |
| All Indica | 2759 | 64.30% | 17.60% | 10.58% | 7.54% | NA |
| All Japonica | 1512 | 11.80% | 38.00% | 12.30% | 37.83% | NA |
| Aus | 269 | 46.10% | 47.20% | 4.09% | 2.60% | NA |
| Indica I | 595 | 64.00% | 16.00% | 11.60% | 8.40% | NA |
| Indica II | 465 | 53.10% | 11.80% | 18.49% | 16.56% | NA |
| Indica III | 913 | 74.20% | 18.20% | 5.26% | 2.41% | NA |
| Indica Intermediate | 786 | 59.50% | 21.60% | 11.32% | 7.51% | NA |
| Temperate Japonica | 767 | 5.00% | 27.50% | 7.04% | 60.50% | NA |
| Tropical Japonica | 504 | 21.60% | 53.00% | 17.06% | 8.33% | NA |
| Japonica Intermediate | 241 | 13.30% | 40.20% | 19.09% | 27.39% | NA |
| VI/Aromatic | 96 | 66.70% | 22.90% | 6.25% | 4.17% | NA |
| Intermediate | 90 | 37.80% | 44.40% | 10.00% | 7.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1127963105 | G -> A | LOC_Os11g46150-LOC_Os11g46180 | intergenic_region ; MODIFIER | silent_mutation | Average:13.288; most accessible tissue: Minghui63 young leaf, score: 20.156 | N | N | N | N |
| vg1127963105 | G -> DEL | N | N | silent_mutation | Average:13.288; most accessible tissue: Minghui63 young leaf, score: 20.156 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1127963105 | NA | 6.92E-06 | mr1075 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127963105 | 3.80E-06 | 2.03E-10 | mr1299 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127963105 | 6.07E-06 | 6.07E-06 | mr1299 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127963105 | NA | 5.80E-06 | mr1304 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127963105 | NA | 2.46E-08 | mr1345 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127963105 | NA | 4.83E-06 | mr1427 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127963105 | NA | 7.35E-06 | mr1634 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127963105 | NA | 5.13E-06 | mr1724 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127963105 | NA | 2.31E-06 | mr1727 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |