\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127869289:

Variant ID: vg1127869289 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 27869289
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTGCGGTCCCCTCAACGTCCTGCTGCCCGATGAGTTCCCGTGCTCGTCGCTCGGCATCCAAGGCGCGCTGCCGCCGGTCCTCAGCCTCCTTCGCAGCCC[G/A]
TTCGCGCTCCTGTTGCTCACGCTGCAGCCGTTCTCGCTCTTGTGCTTGGCGCTCCTCCTCCAGTCGGCGACGTTCGGCTTCTTGTCGCACACGTTGTTCT

Reverse complement sequence

AGAACAACGTGTGCGACAAGAAGCCGAACGTCGCCGACTGGAGGAGGAGCGCCAAGCACAAGAGCGAGAACGGCTGCAGCGTGAGCAACAGGAGCGCGAA[C/T]
GGGCTGCGAAGGAGGCTGAGGACCGGCGGCAGCGCGCCTTGGATGCCGAGCGACGAGCACGGGAACTCATCGGGCAGCAGGACGTTGAGGGGACCGCAGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.80% 1.80% 3.66% 12.74% NA
All Indica  2759 88.40% 0.90% 3.88% 6.85% NA
All Japonica  1512 69.20% 4.00% 3.70% 23.15% NA
Aus  269 91.10% 0.00% 1.86% 7.06% NA
Indica I  595 82.50% 4.00% 7.06% 6.39% NA
Indica II  465 88.40% 0.00% 6.02% 5.59% NA
Indica III  913 91.70% 0.00% 0.88% 7.45% NA
Indica Intermediate  786 89.10% 0.00% 3.69% 7.25% NA
Temperate Japonica  767 52.30% 7.40% 6.52% 33.77% NA
Tropical Japonica  504 92.50% 0.40% 0.40% 6.75% NA
Japonica Intermediate  241 74.30% 0.40% 1.66% 23.65% NA
VI/Aromatic  96 61.50% 0.00% 3.12% 35.42% NA
Intermediate  90 86.70% 0.00% 2.22% 11.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127869289 G -> A LOC_Os11g46040.1 missense_variant ; p.Arg114Trp; MODERATE nonsynonymous_codon ; R114W Average:37.147; most accessible tissue: Zhenshan97 young leaf, score: 67.334 probably damaging 3.033 DELETERIOUS 0.00
vg1127869289 G -> DEL LOC_Os11g46040.1 N frameshift_variant Average:37.147; most accessible tissue: Zhenshan97 young leaf, score: 67.334 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127869289 NA 5.81E-09 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127869289 NA 2.14E-08 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127869289 8.99E-10 8.98E-10 mr1409 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127869289 NA 4.33E-06 mr1515 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127869289 NA 1.98E-09 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127869289 NA 2.16E-08 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127869289 NA 2.87E-07 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127869289 NA 1.07E-08 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127869289 NA 2.15E-06 mr1409_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127869289 NA 2.03E-07 mr1559_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127869289 NA 3.13E-09 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127869289 NA 2.68E-07 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251