\
| Variant ID: vg1127856920 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr11 | Position: 27856920 |
| Reference Allele: CGT | Alternative Allele: C,TGT |
| Primary Allele: CGT | Secondary Allele: TGT |
Inferred Ancestral Allele: Not determined.
GCGAAATTGCAACTTGTGATTGTTATAAGGACGAAGGTTCGGCCAACAAGCACAACCAAACACTCTAAGAAGAGAATAATTGGGTAGTTGTTTAAATAGT[CGT/C,TGT]
TCTAGAGGTGTCTCAAACTTGATGACTTTGTTGGGGGTCCTATTAATAAGATATGCCGCAGTATAAAATACTTCATCCCATAATTTTAAAGGCATAGATG
CATCTATGCCTTTAAAATTATGGGATGAAGTATTTTATACTGCGGCATATCTTATTAATAGGACCCCCAACAAAGTCATCAAGTTTGAGACACCTCTAGA[ACG/G,ACA]
ACTATTTAAACAACTACCCAATTATTCTCTTCTTAGAGTGTTTGGTTGTGCTTGTTGGCCGAACCTTCGTCCTTATAACAATCACAAGTTGCAATTTCGC
| Populations | Population Size | Frequency of CGT(primary allele) | Frequency of TGT(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 79.10% | 1.50% | 3.62% | 15.81% | C: 0.02% |
| All Indica | 2759 | 77.20% | 0.00% | 3.23% | 19.50% | C: 0.04% |
| All Japonica | 1512 | 78.60% | 4.50% | 4.10% | 12.83% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.37% | 0.37% | NA |
| Indica I | 595 | 88.70% | 0.00% | 1.18% | 10.08% | NA |
| Indica II | 465 | 54.80% | 0.00% | 2.15% | 43.01% | NA |
| Indica III | 913 | 85.10% | 0.00% | 4.16% | 10.62% | C: 0.11% |
| Indica Intermediate | 786 | 72.50% | 0.10% | 4.33% | 23.03% | NA |
| Temperate Japonica | 767 | 82.00% | 1.40% | 2.35% | 14.21% | NA |
| Tropical Japonica | 504 | 75.00% | 9.70% | 4.56% | 10.71% | NA |
| Japonica Intermediate | 241 | 75.10% | 3.30% | 8.71% | 12.86% | NA |
| VI/Aromatic | 96 | 83.30% | 0.00% | 14.58% | 2.08% | NA |
| Intermediate | 90 | 81.10% | 0.00% | 5.56% | 13.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1127856920 | CGT -> TGT | LOC_Os11g46020.1 | missense_variant ; p.Arg631Gln; MODERATE | nonsynonymous_codon ; R631Q | Average:61.016; most accessible tissue: Minghui63 root, score: 74.461 | benign |
+0.740 |
N | N |
| vg1127856920 | CGT -> DEL | LOC_Os11g46020.1 | N | frameshift_variant | Average:61.016; most accessible tissue: Minghui63 root, score: 74.461 | N | N | N | N |
| vg1127856920 | CGT -> C | LOC_Os11g46020.1 | frameshift_variant ; p.Arg631fs; HIGH | frameshift_variant | Average:61.016; most accessible tissue: Minghui63 root, score: 74.461 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1127856920 | NA | 3.73E-15 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127856920 | NA | 1.62E-10 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127856920 | NA | 2.10E-07 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127856920 | 8.71E-07 | 5.05E-20 | mr1769_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127856920 | NA | 7.10E-07 | mr1951_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |