Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127845566:

Variant ID: vg1127845566 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 27845566
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.56, A: 0.44, others allele: 0.00, population size: 43. )

Flanking Sequence (100 bp) in Reference Genome:

AGCGTCAGGATTTGCCTCGGGCCCATTGCGATCGGACCATGGCCATTTTGTTTCATGATGGGCCAGGCAATGGTAACGACCCAATCTGAAAGGCTGGTCC[A/G]
GTGATAATGGGCTATCTAATATACATCTAAAATAGTATTAATTTGAATTATTTTTTTTGAGAATAATTAAAAATCGGGCATTTTATTCATTAAGAACCAA

Reverse complement sequence

TTGGTTCTTAATGAATAAAATGCCCGATTTTTAATTATTCTCAAAAAAAATAATTCAAATTAATACTATTTTAGATGTATATTAGATAGCCCATTATCAC[T/C]
GGACCAGCCTTTCAGATTGGGTCGTTACCATTGCCTGGCCCATCATGAAACAAAATGGCCATGGTCCGATCGCAATGGGCCCGAGGCAAATCCTGACGCT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.80%	37.60%	2.90%	14.79%	NA
All Indica	2759	41.80%	29.30%	4.24%	24.65%	NA
All Japonica	1512	47.80%	50.90%	0.86%	0.46%	NA
Aus	269	44.20%	52.00%	1.49%	2.23%	NA
Indica I	595	61.70%	14.30%	2.86%	21.18%	NA
Indica II	465	19.80%	18.90%	8.82%	52.47%	NA
Indica III	913	43.20%	44.80%	1.97%	10.08%	NA
Indica Intermediate	786	38.30%	28.80%	5.22%	27.74%	NA
Temperate Japonica	767	65.80%	33.00%	0.91%	0.26%	NA
Tropical Japonica	504	23.60%	74.80%	0.79%	0.79%	NA
Japonica Intermediate	241	40.70%	58.10%	0.83%	0.41%	NA
VI/Aromatic	96	86.50%	11.50%	0.00%	2.08%	NA
Intermediate	90	41.10%	51.10%	3.33%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1127845566	A -> DEL	N	N	silent_mutation	Average:73.768; most accessible tissue: Callus, score: 97.634	N	N	N	N
vg1127845566	A -> G	LOC_Os11g46000.3	3_prime_UTR_variant ; 755.0bp to feature; MODIFIER	silent_mutation	Average:73.768; most accessible tissue: Callus, score: 97.634	N	N	N	N
vg1127845566	A -> G	LOC_Os11g46000.1	downstream_gene_variant ; 184.0bp to feature; MODIFIER	silent_mutation	Average:73.768; most accessible tissue: Callus, score: 97.634	N	N	N	N
vg1127845566	A -> G	LOC_Os11g46010.1	downstream_gene_variant ; 4926.0bp to feature; MODIFIER	silent_mutation	Average:73.768; most accessible tissue: Callus, score: 97.634	N	N	N	N
vg1127845566	A -> G	LOC_Os11g46000.2	downstream_gene_variant ; 1678.0bp to feature; MODIFIER	silent_mutation	Average:73.768; most accessible tissue: Callus, score: 97.634	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1127845566	A	G	-0.08	-0.13	-0.11	-0.09	-0.08	-0.07

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1127845566	5.31E-06	NA	mr1064	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127845566	4.70E-06	NA	mr1108	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127845566	NA	2.78E-06	mr1207	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127845566	NA	4.51E-07	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127845566	NA	4.22E-07	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127845566	NA	4.06E-06	mr1427	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127845566	NA	7.01E-08	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127845566	1.69E-06	NA	mr1534	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127845566	1.52E-06	1.51E-06	mr1562	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127845566	7.22E-06	NA	mr1745	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251