Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127840328:

Variant ID: vg1127840328 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 27840328
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 43. )

Flanking Sequence (100 bp) in Reference Genome:

ATGTTAGCTAAACATTAGAAAACCCCATGCTTTATGGTCAAAGTTGCATAAAACCCAAAATATCATCACCAGTGTCACATTACTCTAGGTTTTATGGTTC[T/A]
AAAGTTTTACAATACCCCACCCTATATGTGTTGACCACGGATTTACTTAAAATTTTGAGTGTATATGAAATGCTTAACTATTGAGTTCATGACTAAGATT

Reverse complement sequence

AATCTTAGTCATGAACTCAATAGTTAAGCATTTCATATACACTCAAAATTTTAAGTAAATCCGTGGTCAACACATATAGGGTGGGGTATTGTAAAACTTT[A/T]
GAACCATAAAACCTAGAGTAATGTGACACTGGTGATGATATTTTGGGTTTTATGCAACTTTGACCATAAAGCATGGGGTTTTCTAATGTTTAGCTAACAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.10%	37.60%	7.00%	0.32%	NA
All Indica	2759	50.80%	42.80%	5.94%	0.47%	NA
All Japonica	1512	62.60%	29.70%	7.67%	0.00%	NA
Aus	269	60.20%	30.10%	9.29%	0.37%	NA
Indica I	595	33.10%	56.00%	10.42%	0.50%	NA
Indica II	465	52.90%	42.80%	4.09%	0.22%	NA
Indica III	913	61.60%	34.60%	3.50%	0.33%	NA
Indica Intermediate	786	50.40%	42.40%	6.49%	0.76%	NA
Temperate Japonica	767	47.70%	41.30%	10.95%	0.00%	NA
Tropical Japonica	504	83.70%	12.50%	3.77%	0.00%	NA
Japonica Intermediate	241	66.00%	28.60%	5.39%	0.00%	NA
VI/Aromatic	96	32.30%	46.90%	20.83%	0.00%	NA
Intermediate	90	68.90%	23.30%	6.67%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1127840328	T -> A	LOC_Os11g46000.1	upstream_gene_variant ; 1185.0bp to feature; MODIFIER	silent_mutation	Average:30.014; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1127840328	T -> A	LOC_Os11g46000.2	upstream_gene_variant ; 1185.0bp to feature; MODIFIER	silent_mutation	Average:30.014; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1127840328	T -> A	LOC_Os11g46000.3	upstream_gene_variant ; 1716.0bp to feature; MODIFIER	silent_mutation	Average:30.014; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1127840328	T -> A	LOC_Os11g45990-LOC_Os11g46000	intergenic_region ; MODIFIER	silent_mutation	Average:30.014; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1127840328	T -> DEL	N	N	silent_mutation	Average:30.014; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1127840328	9.84E-07	NA	mr1991_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251