\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127802594:

Variant ID: vg1127802594 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 27802594
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, T: 0.14, others allele: 0.00, population size: 73. )

Flanking Sequence (100 bp) in Reference Genome:


GTTTAGTAGTTTGAAAAGCGTGCACGTGAAAAACGAGGGAGATGGGTTGGAAACCCATGGGAAAGAACGTCATTGTCCATGACCTATGCTACACATGTCG[C/T]
AAAGCAAATTTAAACAGCTATAACATTTAAATCACAGCGCTAATTTTTTTAATCCGGTATTTTTTTAAATCATCTGTTGATTTGTTGTTAGTTTGCTTCT

Reverse complement sequence

AGAAGCAAACTAACAACAAATCAACAGATGATTTAAAAAAATACCGGATTAAAAAAATTAGCGCTGTGATTTAAATGTTATAGCTGTTTAAATTTGCTTT[G/A]
CGACATGTGTAGCATAGGTCATGGACAATGACGTTCTTTCCCATGGGTTTCCAACCCATCTCCCTCGTTTTTCACGTGCACGCTTTTCAAACTACTAAAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.80% 8.50% 3.00% 30.72% NA
All Indica  2759 59.00% 9.60% 3.81% 27.51% NA
All Japonica  1512 55.10% 2.60% 2.05% 40.21% NA
Aus  269 63.90% 17.10% 0.74% 18.22% NA
Indica I  595 84.70% 1.50% 0.67% 13.11% NA
Indica II  465 53.50% 21.50% 7.53% 17.42% NA
Indica III  913 55.60% 5.30% 3.29% 35.82% NA
Indica Intermediate  786 46.80% 13.90% 4.58% 34.73% NA
Temperate Japonica  767 59.30% 4.00% 0.78% 35.85% NA
Tropical Japonica  504 45.60% 1.60% 4.76% 48.02% NA
Japonica Intermediate  241 61.40% 0.40% 0.41% 37.76% NA
VI/Aromatic  96 44.80% 44.80% 1.04% 9.38% NA
Intermediate  90 60.00% 6.70% 3.33% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127802594 C -> T LOC_Os11g45960.1 upstream_gene_variant ; 4312.0bp to feature; MODIFIER silent_mutation Average:32.115; most accessible tissue: Callus, score: 49.23 N N N N
vg1127802594 C -> T LOC_Os11g45930.1 downstream_gene_variant ; 4773.0bp to feature; MODIFIER silent_mutation Average:32.115; most accessible tissue: Callus, score: 49.23 N N N N
vg1127802594 C -> T LOC_Os11g45940.1 downstream_gene_variant ; 2299.0bp to feature; MODIFIER silent_mutation Average:32.115; most accessible tissue: Callus, score: 49.23 N N N N
vg1127802594 C -> T LOC_Os11g45950.1 downstream_gene_variant ; 1583.0bp to feature; MODIFIER silent_mutation Average:32.115; most accessible tissue: Callus, score: 49.23 N N N N
vg1127802594 C -> T LOC_Os11g45940-LOC_Os11g45950 intergenic_region ; MODIFIER silent_mutation Average:32.115; most accessible tissue: Callus, score: 49.23 N N N N
vg1127802594 C -> DEL N N silent_mutation Average:32.115; most accessible tissue: Callus, score: 49.23 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127802594 3.90E-06 NA mr1130 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127802594 2.24E-08 5.90E-09 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127802594 NA 9.76E-06 mr1309 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127802594 1.47E-11 1.01E-10 mr1238_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127802594 7.68E-12 2.25E-11 mr1484_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127802594 6.63E-12 6.68E-11 mr1841_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127802594 3.74E-09 2.33E-08 mr1900_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127802594 1.52E-08 1.52E-08 mr1945_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251