\
| Variant ID: vg1127802594 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 27802594 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, T: 0.14, others allele: 0.00, population size: 73. )
GTTTAGTAGTTTGAAAAGCGTGCACGTGAAAAACGAGGGAGATGGGTTGGAAACCCATGGGAAAGAACGTCATTGTCCATGACCTATGCTACACATGTCG[C/T]
AAAGCAAATTTAAACAGCTATAACATTTAAATCACAGCGCTAATTTTTTTAATCCGGTATTTTTTTAAATCATCTGTTGATTTGTTGTTAGTTTGCTTCT
AGAAGCAAACTAACAACAAATCAACAGATGATTTAAAAAAATACCGGATTAAAAAAATTAGCGCTGTGATTTAAATGTTATAGCTGTTTAAATTTGCTTT[G/A]
CGACATGTGTAGCATAGGTCATGGACAATGACGTTCTTTCCCATGGGTTTCCAACCCATCTCCCTCGTTTTTCACGTGCACGCTTTTCAAACTACTAAAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.80% | 8.50% | 3.00% | 30.72% | NA |
| All Indica | 2759 | 59.00% | 9.60% | 3.81% | 27.51% | NA |
| All Japonica | 1512 | 55.10% | 2.60% | 2.05% | 40.21% | NA |
| Aus | 269 | 63.90% | 17.10% | 0.74% | 18.22% | NA |
| Indica I | 595 | 84.70% | 1.50% | 0.67% | 13.11% | NA |
| Indica II | 465 | 53.50% | 21.50% | 7.53% | 17.42% | NA |
| Indica III | 913 | 55.60% | 5.30% | 3.29% | 35.82% | NA |
| Indica Intermediate | 786 | 46.80% | 13.90% | 4.58% | 34.73% | NA |
| Temperate Japonica | 767 | 59.30% | 4.00% | 0.78% | 35.85% | NA |
| Tropical Japonica | 504 | 45.60% | 1.60% | 4.76% | 48.02% | NA |
| Japonica Intermediate | 241 | 61.40% | 0.40% | 0.41% | 37.76% | NA |
| VI/Aromatic | 96 | 44.80% | 44.80% | 1.04% | 9.38% | NA |
| Intermediate | 90 | 60.00% | 6.70% | 3.33% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1127802594 | C -> T | LOC_Os11g45960.1 | upstream_gene_variant ; 4312.0bp to feature; MODIFIER | silent_mutation | Average:32.115; most accessible tissue: Callus, score: 49.23 | N | N | N | N |
| vg1127802594 | C -> T | LOC_Os11g45930.1 | downstream_gene_variant ; 4773.0bp to feature; MODIFIER | silent_mutation | Average:32.115; most accessible tissue: Callus, score: 49.23 | N | N | N | N |
| vg1127802594 | C -> T | LOC_Os11g45940.1 | downstream_gene_variant ; 2299.0bp to feature; MODIFIER | silent_mutation | Average:32.115; most accessible tissue: Callus, score: 49.23 | N | N | N | N |
| vg1127802594 | C -> T | LOC_Os11g45950.1 | downstream_gene_variant ; 1583.0bp to feature; MODIFIER | silent_mutation | Average:32.115; most accessible tissue: Callus, score: 49.23 | N | N | N | N |
| vg1127802594 | C -> T | LOC_Os11g45940-LOC_Os11g45950 | intergenic_region ; MODIFIER | silent_mutation | Average:32.115; most accessible tissue: Callus, score: 49.23 | N | N | N | N |
| vg1127802594 | C -> DEL | N | N | silent_mutation | Average:32.115; most accessible tissue: Callus, score: 49.23 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1127802594 | 3.90E-06 | NA | mr1130 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127802594 | 2.24E-08 | 5.90E-09 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127802594 | NA | 9.76E-06 | mr1309 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127802594 | 1.47E-11 | 1.01E-10 | mr1238_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127802594 | 7.68E-12 | 2.25E-11 | mr1484_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127802594 | 6.63E-12 | 6.68E-11 | mr1841_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127802594 | 3.74E-09 | 2.33E-08 | mr1900_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127802594 | 1.52E-08 | 1.52E-08 | mr1945_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |