\
| Variant ID: vg1127802372 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 27802372 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 113. )
ATATAAGCTGAAACCGAGAGTTGATTATAGAATAATTATTGATGAGTAACCCTACTTGCTGTGTTCTTTTTGAGAGGTTGAGAACCCCTCCCATCCGCAC[G/A]
GAAAACGGAGCGATAGATCAACACGTGATTAATTAAGCATTAGCTATAACAAACTTAAAAATGGATTAATATGATTTTTTAAAGCAACTTTCCTACATAA
TTATGTAGGAAAGTTGCTTTAAAAAATCATATTAATCCATTTTTAAGTTTGTTATAGCTAATGCTTAATTAATCACGTGTTGATCTATCGCTCCGTTTTC[C/T]
GTGCGGATGGGAGGGGTTCTCAACCTCTCAAAAAGAACACAGCAAGTAGGGTTACTCATCAATAATTATTCTATAATCAACTCTCGGTTTCAGCTTATAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.00% | 4.70% | 0.51% | 21.88% | NA |
| All Indica | 2759 | 76.20% | 7.60% | 0.33% | 15.91% | NA |
| All Japonica | 1512 | 64.60% | 0.30% | 0.66% | 34.46% | NA |
| Aus | 269 | 80.30% | 1.10% | 1.12% | 17.47% | NA |
| Indica I | 595 | 88.90% | 0.00% | 0.00% | 11.09% | NA |
| Indica II | 465 | 65.60% | 21.50% | 0.22% | 12.69% | NA |
| Indica III | 913 | 80.30% | 3.40% | 0.55% | 15.77% | NA |
| Indica Intermediate | 786 | 67.90% | 10.10% | 0.38% | 21.63% | NA |
| Temperate Japonica | 767 | 65.10% | 0.00% | 0.52% | 34.42% | NA |
| Tropical Japonica | 504 | 64.10% | 1.00% | 0.60% | 34.33% | NA |
| Japonica Intermediate | 241 | 63.90% | 0.00% | 1.24% | 34.85% | NA |
| VI/Aromatic | 96 | 89.60% | 0.00% | 1.04% | 9.38% | NA |
| Intermediate | 90 | 76.70% | 2.20% | 1.11% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1127802372 | G -> A | LOC_Os11g45960.1 | upstream_gene_variant ; 4534.0bp to feature; MODIFIER | silent_mutation | Average:34.651; most accessible tissue: Minghui63 root, score: 56.226 | N | N | N | N |
| vg1127802372 | G -> A | LOC_Os11g45930.1 | downstream_gene_variant ; 4551.0bp to feature; MODIFIER | silent_mutation | Average:34.651; most accessible tissue: Minghui63 root, score: 56.226 | N | N | N | N |
| vg1127802372 | G -> A | LOC_Os11g45940.1 | downstream_gene_variant ; 2077.0bp to feature; MODIFIER | silent_mutation | Average:34.651; most accessible tissue: Minghui63 root, score: 56.226 | N | N | N | N |
| vg1127802372 | G -> A | LOC_Os11g45950.1 | downstream_gene_variant ; 1805.0bp to feature; MODIFIER | silent_mutation | Average:34.651; most accessible tissue: Minghui63 root, score: 56.226 | N | N | N | N |
| vg1127802372 | G -> A | LOC_Os11g45940-LOC_Os11g45950 | intergenic_region ; MODIFIER | silent_mutation | Average:34.651; most accessible tissue: Minghui63 root, score: 56.226 | N | N | N | N |
| vg1127802372 | G -> DEL | N | N | silent_mutation | Average:34.651; most accessible tissue: Minghui63 root, score: 56.226 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1127802372 | 5.20E-08 | 1.33E-08 | mr1238 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127802372 | 8.01E-06 | NA | mr1841 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127802372 | 4.51E-12 | 3.54E-11 | mr1238_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127802372 | 9.45E-06 | NA | mr1242_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127802372 | 1.16E-12 | 4.45E-12 | mr1484_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127802372 | 8.05E-06 | NA | mr1609_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127802372 | 3.46E-12 | 8.00E-11 | mr1841_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127802372 | 4.67E-09 | 1.51E-08 | mr1900_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127802372 | 1.78E-09 | 1.78E-09 | mr1945_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |