\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127802372:

Variant ID: vg1127802372 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 27802372
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


ATATAAGCTGAAACCGAGAGTTGATTATAGAATAATTATTGATGAGTAACCCTACTTGCTGTGTTCTTTTTGAGAGGTTGAGAACCCCTCCCATCCGCAC[G/A]
GAAAACGGAGCGATAGATCAACACGTGATTAATTAAGCATTAGCTATAACAAACTTAAAAATGGATTAATATGATTTTTTAAAGCAACTTTCCTACATAA

Reverse complement sequence

TTATGTAGGAAAGTTGCTTTAAAAAATCATATTAATCCATTTTTAAGTTTGTTATAGCTAATGCTTAATTAATCACGTGTTGATCTATCGCTCCGTTTTC[C/T]
GTGCGGATGGGAGGGGTTCTCAACCTCTCAAAAAGAACACAGCAAGTAGGGTTACTCATCAATAATTATTCTATAATCAACTCTCGGTTTCAGCTTATAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.00% 4.70% 0.51% 21.88% NA
All Indica  2759 76.20% 7.60% 0.33% 15.91% NA
All Japonica  1512 64.60% 0.30% 0.66% 34.46% NA
Aus  269 80.30% 1.10% 1.12% 17.47% NA
Indica I  595 88.90% 0.00% 0.00% 11.09% NA
Indica II  465 65.60% 21.50% 0.22% 12.69% NA
Indica III  913 80.30% 3.40% 0.55% 15.77% NA
Indica Intermediate  786 67.90% 10.10% 0.38% 21.63% NA
Temperate Japonica  767 65.10% 0.00% 0.52% 34.42% NA
Tropical Japonica  504 64.10% 1.00% 0.60% 34.33% NA
Japonica Intermediate  241 63.90% 0.00% 1.24% 34.85% NA
VI/Aromatic  96 89.60% 0.00% 1.04% 9.38% NA
Intermediate  90 76.70% 2.20% 1.11% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127802372 G -> A LOC_Os11g45960.1 upstream_gene_variant ; 4534.0bp to feature; MODIFIER silent_mutation Average:34.651; most accessible tissue: Minghui63 root, score: 56.226 N N N N
vg1127802372 G -> A LOC_Os11g45930.1 downstream_gene_variant ; 4551.0bp to feature; MODIFIER silent_mutation Average:34.651; most accessible tissue: Minghui63 root, score: 56.226 N N N N
vg1127802372 G -> A LOC_Os11g45940.1 downstream_gene_variant ; 2077.0bp to feature; MODIFIER silent_mutation Average:34.651; most accessible tissue: Minghui63 root, score: 56.226 N N N N
vg1127802372 G -> A LOC_Os11g45950.1 downstream_gene_variant ; 1805.0bp to feature; MODIFIER silent_mutation Average:34.651; most accessible tissue: Minghui63 root, score: 56.226 N N N N
vg1127802372 G -> A LOC_Os11g45940-LOC_Os11g45950 intergenic_region ; MODIFIER silent_mutation Average:34.651; most accessible tissue: Minghui63 root, score: 56.226 N N N N
vg1127802372 G -> DEL N N silent_mutation Average:34.651; most accessible tissue: Minghui63 root, score: 56.226 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127802372 5.20E-08 1.33E-08 mr1238 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127802372 8.01E-06 NA mr1841 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127802372 4.51E-12 3.54E-11 mr1238_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127802372 9.45E-06 NA mr1242_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127802372 1.16E-12 4.45E-12 mr1484_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127802372 8.05E-06 NA mr1609_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127802372 3.46E-12 8.00E-11 mr1841_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127802372 4.67E-09 1.51E-08 mr1900_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127802372 1.78E-09 1.78E-09 mr1945_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251