\
| Variant ID: vg1127790146 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 27790146 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 94. )
TTAGTAGGTGGAGGTGCATCTTCTACATTATTGAAGTGAATAGATAATCGTCGAACCTTGTCAGCAAATCTTATAGTTGCCTGTGAATGGTCTATTGCAA[T/C]
AATAAAATTCTCTTCTATTGACTTGTATGTAACAAAATTGAGTACAATATGGTGAACTACACAGGACAAAACCTCACCGCTGTCATCGATATGGACAGGC
GCCTGTCCATATCGATGACAGCGGTGAGGTTTTGTCCTGTGTAGTTCACCATATTGTACTCAATTTTGTTACATACAAGTCAATAGAAGAGAATTTTATT[A/G]
TTGCAATAGACCATTCACAGGCAACTATAAGATTTGCTGACAAGGTTCGACGATTATCTATTCACTTCAATAATGTAGAAGATGCACCTCCACCTACTAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.20% | 1.90% | 4.59% | 0.36% | NA |
| All Indica | 2759 | 91.60% | 2.10% | 5.73% | 0.54% | NA |
| All Japonica | 1512 | 98.30% | 0.60% | 1.12% | 0.00% | NA |
| Aus | 269 | 89.60% | 2.60% | 7.06% | 0.74% | NA |
| Indica I | 595 | 89.10% | 3.90% | 7.06% | 0.00% | NA |
| Indica II | 465 | 88.20% | 0.40% | 9.25% | 2.15% | NA |
| Indica III | 913 | 96.30% | 1.80% | 1.86% | 0.11% | NA |
| Indica Intermediate | 786 | 90.10% | 2.30% | 7.12% | 0.51% | NA |
| Temperate Japonica | 767 | 98.40% | 0.30% | 1.30% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.00% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.40% | 2.90% | 1.66% | 0.00% | NA |
| VI/Aromatic | 96 | 67.70% | 9.40% | 22.92% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 4.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1127790146 | T -> DEL | LOC_Os11g45924.1 | N | frameshift_variant | Average:48.567; most accessible tissue: Minghui63 root, score: 69.344 | N | N | N | N |
| vg1127790146 | T -> C | LOC_Os11g45924.1 | missense_variant ; p.Ile378Val; MODERATE | nonsynonymous_codon ; I378V | Average:48.567; most accessible tissue: Minghui63 root, score: 69.344 | benign |
0.169 |
TOLERATED | 0.43 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1127790146 | NA | 4.00E-06 | mr1049 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127790146 | 4.94E-07 | 1.32E-07 | mr1285 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127790146 | 1.90E-06 | 1.07E-06 | mr1501 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127790146 | NA | 7.03E-07 | mr1592 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127790146 | 8.09E-06 | 3.81E-06 | mr1656 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127790146 | NA | 6.42E-06 | mr1696 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127790146 | NA | 1.60E-07 | mr1662_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127790146 | NA | 1.32E-06 | mr1662_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |