\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127790146:

Variant ID: vg1127790146 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 27790146
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.01, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


TTAGTAGGTGGAGGTGCATCTTCTACATTATTGAAGTGAATAGATAATCGTCGAACCTTGTCAGCAAATCTTATAGTTGCCTGTGAATGGTCTATTGCAA[T/C]
AATAAAATTCTCTTCTATTGACTTGTATGTAACAAAATTGAGTACAATATGGTGAACTACACAGGACAAAACCTCACCGCTGTCATCGATATGGACAGGC

Reverse complement sequence

GCCTGTCCATATCGATGACAGCGGTGAGGTTTTGTCCTGTGTAGTTCACCATATTGTACTCAATTTTGTTACATACAAGTCAATAGAAGAGAATTTTATT[A/G]
TTGCAATAGACCATTCACAGGCAACTATAAGATTTGCTGACAAGGTTCGACGATTATCTATTCACTTCAATAATGTAGAAGATGCACCTCCACCTACTAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.20% 1.90% 4.59% 0.36% NA
All Indica  2759 91.60% 2.10% 5.73% 0.54% NA
All Japonica  1512 98.30% 0.60% 1.12% 0.00% NA
Aus  269 89.60% 2.60% 7.06% 0.74% NA
Indica I  595 89.10% 3.90% 7.06% 0.00% NA
Indica II  465 88.20% 0.40% 9.25% 2.15% NA
Indica III  913 96.30% 1.80% 1.86% 0.11% NA
Indica Intermediate  786 90.10% 2.30% 7.12% 0.51% NA
Temperate Japonica  767 98.40% 0.30% 1.30% 0.00% NA
Tropical Japonica  504 99.40% 0.00% 0.60% 0.00% NA
Japonica Intermediate  241 95.40% 2.90% 1.66% 0.00% NA
VI/Aromatic  96 67.70% 9.40% 22.92% 0.00% NA
Intermediate  90 94.40% 4.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127790146 T -> DEL LOC_Os11g45924.1 N frameshift_variant Average:48.567; most accessible tissue: Minghui63 root, score: 69.344 N N N N
vg1127790146 T -> C LOC_Os11g45924.1 missense_variant ; p.Ile378Val; MODERATE nonsynonymous_codon ; I378V Average:48.567; most accessible tissue: Minghui63 root, score: 69.344 benign 0.169 TOLERATED 0.43

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127790146 NA 4.00E-06 mr1049 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790146 4.94E-07 1.32E-07 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790146 1.90E-06 1.07E-06 mr1501 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790146 NA 7.03E-07 mr1592 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790146 8.09E-06 3.81E-06 mr1656 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790146 NA 6.42E-06 mr1696 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790146 NA 1.60E-07 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790146 NA 1.32E-06 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251