\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127790119:

Variant ID: vg1127790119 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 27790119
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


ATTGTCCGAACTTGGAACAATCTCATATTAGTAGGTGGAGGTGCATCTTCTACATTATTGAAGTGAATAGATAATCGTCGAACCTTGTCAGCAAATCTTA[T/C]
AGTTGCCTGTGAATGGTCTATTGCAATAATAAAATTCTCTTCTATTGACTTGTATGTAACAAAATTGAGTACAATATGGTGAACTACACAGGACAAAACC

Reverse complement sequence

GGTTTTGTCCTGTGTAGTTCACCATATTGTACTCAATTTTGTTACATACAAGTCAATAGAAGAGAATTTTATTATTGCAATAGACCATTCACAGGCAACT[A/G]
TAAGATTTGCTGACAAGGTTCGACGATTATCTATTCACTTCAATAATGTAGAAGATGCACCTCCACCTACTAATATGAGATTGTTCCAAGTTCGGACAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.60% 7.20% 3.11% 0.08% NA
All Indica  2759 88.10% 8.60% 3.15% 0.11% NA
All Japonica  1512 96.30% 1.90% 1.85% 0.00% NA
Aus  269 77.30% 12.60% 10.04% 0.00% NA
Indica I  595 84.40% 12.60% 3.03% 0.00% NA
Indica II  465 82.60% 11.60% 5.38% 0.43% NA
Indica III  913 94.70% 4.20% 1.10% 0.00% NA
Indica Intermediate  786 86.60% 8.90% 4.33% 0.13% NA
Temperate Japonica  767 95.30% 1.80% 2.87% 0.00% NA
Tropical Japonica  504 98.60% 0.80% 0.60% 0.00% NA
Japonica Intermediate  241 94.60% 4.10% 1.24% 0.00% NA
VI/Aromatic  96 59.40% 35.40% 4.17% 1.04% NA
Intermediate  90 92.20% 6.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127790119 T -> DEL LOC_Os11g45924.1 N frameshift_variant Average:48.267; most accessible tissue: Minghui63 root, score: 70.332 N N N N
vg1127790119 T -> C LOC_Os11g45924.1 missense_variant ; p.Ile387Val; MODERATE nonsynonymous_codon ; I387V Average:48.267; most accessible tissue: Minghui63 root, score: 70.332 benign 0.698 TOLERATED 0.86

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127790119 NA 5.24E-07 mr1049 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790119 2.91E-08 7.48E-09 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790119 6.10E-06 NA mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790119 7.57E-06 7.57E-06 mr1299 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790119 NA 5.51E-06 mr1347 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790119 6.04E-06 6.03E-06 mr1452 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790119 4.69E-06 4.70E-06 mr1476 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790119 7.29E-07 7.52E-07 mr1501 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790119 7.18E-06 1.91E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790119 5.81E-06 3.03E-08 mr1592 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790119 3.21E-07 1.38E-07 mr1656 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790119 NA 7.25E-07 mr1696 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790119 NA 5.83E-06 mr1909 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790119 3.90E-06 1.10E-07 mr1921 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790119 NA 4.42E-06 mr1964 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790119 NA 9.52E-08 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790119 NA 4.45E-06 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251