\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127790110:

Variant ID: vg1127790110 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 27790110
Reference Allele: CAlternative Allele: A,T,CTAT
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 90. )

Flanking Sequence (100 bp) in Reference Genome:


AAGAAGGCAATTGTCCGAACTTGGAACAATCTCATATTAGTAGGTGGAGGTGCATCTTCTACATTATTGAAGTGAATAGATAATCGTCGAACCTTGTCAG[C/A,T,CTAT]
AAATCTTATAGTTGCCTGTGAATGGTCTATTGCAATAATAAAATTCTCTTCTATTGACTTGTATGTAACAAAATTGAGTACAATATGGTGAACTACACAG

Reverse complement sequence

CTGTGTAGTTCACCATATTGTACTCAATTTTGTTACATACAAGTCAATAGAAGAGAATTTTATTATTGCAATAGACCATTCACAGGCAACTATAAGATTT[G/T,A,ATAG]
CTGACAAGGTTCGACGATTATCTATTCACTTCAATAATGTAGAAGATGCACCTCCACCTACTAATATGAGATTGTTCCAAGTTCGGACAATTGCCTTCTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.80% 8.70% 2.43% 0.02% T: 0.06%
All Indica  2759 87.40% 10.90% 1.67% 0.00% T: 0.04%
All Japonica  1512 95.30% 1.90% 2.58% 0.07% T: 0.13%
Aus  269 76.60% 14.10% 9.29% 0.00% NA
Indica I  595 83.50% 13.30% 3.03% 0.00% T: 0.17%
Indica II  465 81.70% 16.30% 1.94% 0.00% NA
Indica III  913 94.30% 5.30% 0.44% 0.00% NA
Indica Intermediate  786 85.50% 12.60% 1.91% 0.00% NA
Temperate Japonica  767 93.50% 2.00% 4.17% 0.13% T: 0.26%
Tropical Japonica  504 98.40% 0.80% 0.79% 0.00% NA
Japonica Intermediate  241 94.60% 4.10% 1.24% 0.00% NA
VI/Aromatic  96 59.40% 36.50% 4.17% 0.00% NA
Intermediate  90 92.20% 6.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127790110 C -> T LOC_Os11g45924.1 missense_variant ; p.Ala390Thr; MODERATE nonsynonymous_codon ; A390T Average:48.017; most accessible tissue: Minghui63 root, score: 70.332 possibly damaging 1.866 DELETERIOUS 0.02
vg1127790110 C -> A LOC_Os11g45924.1 missense_variant ; p.Ala390Ser; MODERATE nonsynonymous_codon ; A390S Average:48.017; most accessible tissue: Minghui63 root, score: 70.332 benign 0.885 TOLERATED 0.21
vg1127790110 C -> DEL LOC_Os11g45924.1 N frameshift_variant Average:48.017; most accessible tissue: Minghui63 root, score: 70.332 N N N N
vg1127790110 C -> CTAT LOC_Os11g45924.1 inframe_insertion ; p.Phe389_Ala390insIle; MODERATE N Average:48.017; most accessible tissue: Minghui63 root, score: 70.332 N N N N
vg1127790110 C -> CTAT LOC_Os11g45920.1 upstream_gene_variant ; 4129.0bp to feature; MODIFIER N Average:48.017; most accessible tissue: Minghui63 root, score: 70.332 N N N N
vg1127790110 C -> CTAT LOC_Os11g45930.1 upstream_gene_variant ; 3666.0bp to feature; MODIFIER N Average:48.017; most accessible tissue: Minghui63 root, score: 70.332 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127790110 NA 4.59E-07 mr1049 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790110 NA 8.22E-06 mr1100 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790110 4.99E-06 4.99E-06 mr1160 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790110 2.54E-08 6.95E-09 mr1285 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790110 5.07E-06 5.27E-06 mr1285 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790110 7.85E-06 7.85E-06 mr1299 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790110 6.92E-06 6.91E-06 mr1452 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790110 7.03E-06 7.04E-06 mr1476 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790110 1.63E-06 1.52E-06 mr1501 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790110 5.76E-06 1.83E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790110 6.18E-06 NA mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790110 5.81E-06 2.68E-08 mr1592 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790110 3.28E-07 1.49E-07 mr1656 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790110 NA 1.83E-06 mr1662 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790110 NA 1.08E-06 mr1696 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790110 5.54E-06 2.36E-07 mr1921 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790110 NA 6.65E-06 mr1964 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790110 NA 1.31E-07 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127790110 NA 6.83E-06 mr1662_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251