\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127789167:

Variant ID: vg1127789167 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 27789167
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


TGCTCTATGGACATCAAAACCTAACTTGAGCTTCCTTAGACTAGGCATTGCACCAACCTCAAATTTCATCCATGCTACACTGCATATAAACTTGAAGTAT[C/T]
TGAGGATTGAGAACCCTGCATTGTCAAAGACAATCCTTTCTGCAGGCTTTGTGTGGACATAAAGTGACAAAACAGTGAGCTCTGGTAATACTCCGAGAAC

Reverse complement sequence

GTTCTCGGAGTATTACCAGAGCTCACTGTTTTGTCACTTTATGTCCACACAAAGCCTGCAGAAAGGATTGTCTTTGACAATGCAGGGTTCTCAATCCTCA[G/A]
ATACTTCAAGTTTATATGCAGTGTAGCATGGATGAAATTTGAGGTTGGTGCAATGCCTAGTCTAAGGAAGCTCAAGTTAGGTTTTGATGTCCATAGAGCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.80% 10.60% 2.24% 2.35% NA
All Indica  2759 82.60% 12.30% 2.72% 2.39% NA
All Japonica  1512 91.30% 4.80% 0.99% 2.91% NA
Aus  269 77.30% 17.50% 4.83% 0.37% NA
Indica I  595 84.00% 14.80% 1.01% 0.17% NA
Indica II  465 74.00% 19.60% 3.66% 2.80% NA
Indica III  913 89.30% 5.50% 2.63% 2.63% NA
Indica Intermediate  786 78.80% 14.10% 3.56% 3.56% NA
Temperate Japonica  767 91.70% 5.70% 1.56% 1.04% NA
Tropical Japonica  504 89.70% 2.80% 0.40% 7.14% NA
Japonica Intermediate  241 93.40% 6.20% 0.41% 0.00% NA
VI/Aromatic  96 59.40% 37.50% 3.12% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127789167 C -> T LOC_Os11g45920.1 upstream_gene_variant ; 3185.0bp to feature; MODIFIER silent_mutation Average:42.105; most accessible tissue: Minghui63 flag leaf, score: 67.635 N N N N
vg1127789167 C -> T LOC_Os11g45930.1 upstream_gene_variant ; 4610.0bp to feature; MODIFIER silent_mutation Average:42.105; most accessible tissue: Minghui63 flag leaf, score: 67.635 N N N N
vg1127789167 C -> T LOC_Os11g45924.1 downstream_gene_variant ; 451.0bp to feature; MODIFIER silent_mutation Average:42.105; most accessible tissue: Minghui63 flag leaf, score: 67.635 N N N N
vg1127789167 C -> T LOC_Os11g45920-LOC_Os11g45924 intergenic_region ; MODIFIER silent_mutation Average:42.105; most accessible tissue: Minghui63 flag leaf, score: 67.635 N N N N
vg1127789167 C -> DEL N N silent_mutation Average:42.105; most accessible tissue: Minghui63 flag leaf, score: 67.635 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127789167 NA 5.01E-06 mr1036 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127789167 NA 3.74E-06 mr1049 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127789167 3.92E-06 2.43E-06 mr1285 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127789167 2.03E-06 2.81E-06 mr1339 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127789167 NA 1.79E-06 mr1347 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127789167 NA 7.75E-06 mr1376 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127789167 NA 2.90E-06 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127789167 NA 7.75E-06 mr1431 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127789167 NA 2.32E-06 mr1526 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127789167 NA 7.14E-07 mr1592 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127789167 NA 6.92E-07 mr1696 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127789167 4.37E-06 4.12E-08 mr1921 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127789167 NA 8.31E-06 mr1964 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251