\
| Variant ID: vg1127789167 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 27789167 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 236. )
TGCTCTATGGACATCAAAACCTAACTTGAGCTTCCTTAGACTAGGCATTGCACCAACCTCAAATTTCATCCATGCTACACTGCATATAAACTTGAAGTAT[C/T]
TGAGGATTGAGAACCCTGCATTGTCAAAGACAATCCTTTCTGCAGGCTTTGTGTGGACATAAAGTGACAAAACAGTGAGCTCTGGTAATACTCCGAGAAC
GTTCTCGGAGTATTACCAGAGCTCACTGTTTTGTCACTTTATGTCCACACAAAGCCTGCAGAAAGGATTGTCTTTGACAATGCAGGGTTCTCAATCCTCA[G/A]
ATACTTCAAGTTTATATGCAGTGTAGCATGGATGAAATTTGAGGTTGGTGCAATGCCTAGTCTAAGGAAGCTCAAGTTAGGTTTTGATGTCCATAGAGCA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 84.80% | 10.60% | 2.24% | 2.35% | NA |
| All Indica | 2759 | 82.60% | 12.30% | 2.72% | 2.39% | NA |
| All Japonica | 1512 | 91.30% | 4.80% | 0.99% | 2.91% | NA |
| Aus | 269 | 77.30% | 17.50% | 4.83% | 0.37% | NA |
| Indica I | 595 | 84.00% | 14.80% | 1.01% | 0.17% | NA |
| Indica II | 465 | 74.00% | 19.60% | 3.66% | 2.80% | NA |
| Indica III | 913 | 89.30% | 5.50% | 2.63% | 2.63% | NA |
| Indica Intermediate | 786 | 78.80% | 14.10% | 3.56% | 3.56% | NA |
| Temperate Japonica | 767 | 91.70% | 5.70% | 1.56% | 1.04% | NA |
| Tropical Japonica | 504 | 89.70% | 2.80% | 0.40% | 7.14% | NA |
| Japonica Intermediate | 241 | 93.40% | 6.20% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 59.40% | 37.50% | 3.12% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1127789167 | C -> T | LOC_Os11g45920.1 | upstream_gene_variant ; 3185.0bp to feature; MODIFIER | silent_mutation | Average:42.105; most accessible tissue: Minghui63 flag leaf, score: 67.635 | N | N | N | N |
| vg1127789167 | C -> T | LOC_Os11g45930.1 | upstream_gene_variant ; 4610.0bp to feature; MODIFIER | silent_mutation | Average:42.105; most accessible tissue: Minghui63 flag leaf, score: 67.635 | N | N | N | N |
| vg1127789167 | C -> T | LOC_Os11g45924.1 | downstream_gene_variant ; 451.0bp to feature; MODIFIER | silent_mutation | Average:42.105; most accessible tissue: Minghui63 flag leaf, score: 67.635 | N | N | N | N |
| vg1127789167 | C -> T | LOC_Os11g45920-LOC_Os11g45924 | intergenic_region ; MODIFIER | silent_mutation | Average:42.105; most accessible tissue: Minghui63 flag leaf, score: 67.635 | N | N | N | N |
| vg1127789167 | C -> DEL | N | N | silent_mutation | Average:42.105; most accessible tissue: Minghui63 flag leaf, score: 67.635 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1127789167 | NA | 5.01E-06 | mr1036 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127789167 | NA | 3.74E-06 | mr1049 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127789167 | 3.92E-06 | 2.43E-06 | mr1285 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127789167 | 2.03E-06 | 2.81E-06 | mr1339 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127789167 | NA | 1.79E-06 | mr1347 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127789167 | NA | 7.75E-06 | mr1376 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127789167 | NA | 2.90E-06 | mr1382 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127789167 | NA | 7.75E-06 | mr1431 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127789167 | NA | 2.32E-06 | mr1526 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127789167 | NA | 7.14E-07 | mr1592 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127789167 | NA | 6.92E-07 | mr1696 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127789167 | 4.37E-06 | 4.12E-08 | mr1921 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127789167 | NA | 8.31E-06 | mr1964 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |