Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127770033:

Variant ID: vg1127770033 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 27770033
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, C: 0.09, others allele: 0.00, population size: 80. )

Flanking Sequence (100 bp) in Reference Genome:

ACAAAGTTAGTGACATGGTTCTTCATGAAGAGGATGGATAGGTGGTTGTTGGGACAATACCATGTCCTATGGAGCGAGCCGAAAGGGTGAAACAAAAGGA[T/C]
GTGCTAGTTTACCAAAGAAGGCGGTTTGATAATCAGGGGAAGAAAAGAAAGAAGTCAGTGCAAGATCAGGTTGAAGAGTTACCACACCCATAATGCCCAG

Reverse complement sequence

CTGGGCATTATGGGTGTGGTAACTCTTCAACCTGATCTTGCACTGACTTCTTTCTTTTCTTCCCCTGATTATCAAACCGCCTTCTTTGGTAAACTAGCAC[A/G]
TCCTTTTGTTTCACCCTTTCGGCTCGCTCCATAGGACATGGTATTGTCCCAACAACCACCTATCCATCCTCTTCATGAAGAACCATGTCACTAACTTTGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.90%	17.20%	0.59%	35.29%	NA
All Indica	2759	34.90%	24.40%	0.72%	40.05%	NA
All Japonica	1512	71.40%	7.90%	0.40%	20.37%	NA
Aus	269	31.60%	1.90%	0.37%	66.17%	NA
Indica I	595	31.80%	11.90%	1.34%	54.96%	NA
Indica II	465	29.70%	8.80%	1.08%	60.43%	NA
Indica III	913	38.80%	44.40%	0.22%	16.65%	NA
Indica Intermediate	786	35.80%	19.70%	0.64%	43.89%	NA
Temperate Japonica	767	80.40%	3.00%	0.52%	16.04%	NA
Tropical Japonica	504	53.80%	17.10%	0.40%	28.77%	NA
Japonica Intermediate	241	79.30%	4.10%	0.00%	16.60%	NA
VI/Aromatic	96	37.50%	2.10%	1.04%	59.38%	NA
Intermediate	90	60.00%	17.80%	0.00%	22.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1127770033	T -> DEL	N	N	silent_mutation	Average:28.316; most accessible tissue: Zhenshan97 young leaf, score: 58.398	N	N	N	N
vg1127770033	T -> C	LOC_Os11g45899.1	downstream_gene_variant ; 2515.0bp to feature; MODIFIER	silent_mutation	Average:28.316; most accessible tissue: Zhenshan97 young leaf, score: 58.398	N	N	N	N
vg1127770033	T -> C	LOC_Os11g45908.1	intron_variant ; MODIFIER	silent_mutation	Average:28.316; most accessible tissue: Zhenshan97 young leaf, score: 58.398	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1127770033	NA	3.01E-07	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127770033	6.70E-06	NA	mr1133	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127770033	3.56E-06	7.23E-09	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127770033	NA	9.70E-06	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127770033	NA	3.34E-06	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127770033	1.48E-06	NA	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127770033	1.34E-06	1.38E-09	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127770033	4.53E-06	1.23E-07	mr1667_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251