\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127764793:

Variant ID: vg1127764793 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 27764793
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, A: 0.09, others allele: 0.00, population size: 81. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGATCTGAGCTTCTAATTCCTCCCATTGGAAAAATATGATAAGCTGCAGTGCATAGAGGGGTAAAACTTAGCATTTTGTACAATGGTTTGTACCAAAA[A/T]
TTTATAAAAACATACCACTTGGATCTAACAAAACGGTCAAAGATCATAGAATTTGGTAAAGGGAGAGCAATAATCTGTACTAGAATGCCAGAAGTCTCCC

Reverse complement sequence

GGGAGACTTCTGGCATTCTAGTACAGATTATTGCTCTCCCTTTACCAAATTCTATGATCTTTGACCGTTTTGTTAGATCCAAGTGGTATGTTTTTATAAA[T/A]
TTTTGGTACAAACCATTGTACAAAATGCTAAGTTTTACCCCTCTATGCACTGCAGCTTATCATATTTTTCCAATGGGAGGAATTAGAAGCTCAGATCAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.60% 25.20% 0.44% 35.72% NA
All Indica  2759 26.60% 32.70% 0.36% 40.41% NA
All Japonica  1512 64.70% 14.00% 0.40% 20.90% NA
Aus  269 18.60% 14.50% 0.37% 66.54% NA
Indica I  595 25.40% 18.80% 0.50% 55.29% NA
Indica II  465 26.50% 11.20% 0.86% 61.51% NA
Indica III  913 29.10% 53.70% 0.00% 17.20% NA
Indica Intermediate  786 24.60% 31.40% 0.38% 43.64% NA
Temperate Japonica  767 68.60% 14.30% 0.52% 16.56% NA
Tropical Japonica  504 52.60% 17.50% 0.40% 29.56% NA
Japonica Intermediate  241 78.00% 5.40% 0.00% 16.60% NA
VI/Aromatic  96 29.20% 9.40% 2.08% 59.38% NA
Intermediate  90 37.80% 36.70% 2.22% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127764793 A -> T LOC_Os11g45890.1 upstream_gene_variant ; 3146.0bp to feature; MODIFIER silent_mutation Average:44.432; most accessible tissue: Callus, score: 80.347 N N N N
vg1127764793 A -> T LOC_Os11g45899.1 upstream_gene_variant ; 138.0bp to feature; MODIFIER silent_mutation Average:44.432; most accessible tissue: Callus, score: 80.347 N N N N
vg1127764793 A -> T LOC_Os11g45908.1 upstream_gene_variant ; 3210.0bp to feature; MODIFIER silent_mutation Average:44.432; most accessible tissue: Callus, score: 80.347 N N N N
vg1127764793 A -> T LOC_Os11g45890-LOC_Os11g45899 intergenic_region ; MODIFIER silent_mutation Average:44.432; most accessible tissue: Callus, score: 80.347 N N N N
vg1127764793 A -> DEL N N silent_mutation Average:44.432; most accessible tissue: Callus, score: 80.347 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127764793 2.49E-08 NA mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127764793 9.52E-07 6.52E-12 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127764793 NA 1.62E-07 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127764793 4.79E-07 1.11E-11 mr1133_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127764793 NA 2.22E-08 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251