\
| Variant ID: vg1127764793 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 27764793 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.91, A: 0.09, others allele: 0.00, population size: 81. )
TTTGATCTGAGCTTCTAATTCCTCCCATTGGAAAAATATGATAAGCTGCAGTGCATAGAGGGGTAAAACTTAGCATTTTGTACAATGGTTTGTACCAAAA[A/T]
TTTATAAAAACATACCACTTGGATCTAACAAAACGGTCAAAGATCATAGAATTTGGTAAAGGGAGAGCAATAATCTGTACTAGAATGCCAGAAGTCTCCC
GGGAGACTTCTGGCATTCTAGTACAGATTATTGCTCTCCCTTTACCAAATTCTATGATCTTTGACCGTTTTGTTAGATCCAAGTGGTATGTTTTTATAAA[T/A]
TTTTGGTACAAACCATTGTACAAAATGCTAAGTTTTACCCCTCTATGCACTGCAGCTTATCATATTTTTCCAATGGGAGGAATTAGAAGCTCAGATCAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.60% | 25.20% | 0.44% | 35.72% | NA |
| All Indica | 2759 | 26.60% | 32.70% | 0.36% | 40.41% | NA |
| All Japonica | 1512 | 64.70% | 14.00% | 0.40% | 20.90% | NA |
| Aus | 269 | 18.60% | 14.50% | 0.37% | 66.54% | NA |
| Indica I | 595 | 25.40% | 18.80% | 0.50% | 55.29% | NA |
| Indica II | 465 | 26.50% | 11.20% | 0.86% | 61.51% | NA |
| Indica III | 913 | 29.10% | 53.70% | 0.00% | 17.20% | NA |
| Indica Intermediate | 786 | 24.60% | 31.40% | 0.38% | 43.64% | NA |
| Temperate Japonica | 767 | 68.60% | 14.30% | 0.52% | 16.56% | NA |
| Tropical Japonica | 504 | 52.60% | 17.50% | 0.40% | 29.56% | NA |
| Japonica Intermediate | 241 | 78.00% | 5.40% | 0.00% | 16.60% | NA |
| VI/Aromatic | 96 | 29.20% | 9.40% | 2.08% | 59.38% | NA |
| Intermediate | 90 | 37.80% | 36.70% | 2.22% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1127764793 | A -> T | LOC_Os11g45890.1 | upstream_gene_variant ; 3146.0bp to feature; MODIFIER | silent_mutation | Average:44.432; most accessible tissue: Callus, score: 80.347 | N | N | N | N |
| vg1127764793 | A -> T | LOC_Os11g45899.1 | upstream_gene_variant ; 138.0bp to feature; MODIFIER | silent_mutation | Average:44.432; most accessible tissue: Callus, score: 80.347 | N | N | N | N |
| vg1127764793 | A -> T | LOC_Os11g45908.1 | upstream_gene_variant ; 3210.0bp to feature; MODIFIER | silent_mutation | Average:44.432; most accessible tissue: Callus, score: 80.347 | N | N | N | N |
| vg1127764793 | A -> T | LOC_Os11g45890-LOC_Os11g45899 | intergenic_region ; MODIFIER | silent_mutation | Average:44.432; most accessible tissue: Callus, score: 80.347 | N | N | N | N |
| vg1127764793 | A -> DEL | N | N | silent_mutation | Average:44.432; most accessible tissue: Callus, score: 80.347 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1127764793 | 2.49E-08 | NA | mr1133 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127764793 | 9.52E-07 | 6.52E-12 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127764793 | NA | 1.62E-07 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127764793 | 4.79E-07 | 1.11E-11 | mr1133_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127764793 | NA | 2.22E-08 | mr1667_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |