\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127763517:

Variant ID: vg1127763517 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 27763517
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAAATTCGACTCCGCATCCCATACGCACACAATATCTCCATCGTATGCCATATGGAATCTTCACTAATCACGTGCATTGATCTTTAGCCTAAGTATCCCG[C/T]
ATGATATCTGACCGTCCAGACGTTACCTTATCTCCAAGTTGACTCCCGATCCATCACTAGCAATATTCTCCCGAGACATCAAGACACCTACACATGAATC

Reverse complement sequence

GATTCATGTGTAGGTGTCTTGATGTCTCGGGAGAATATTGCTAGTGATGGATCGGGAGTCAACTTGGAGATAAGGTAACGTCTGGACGGTCAGATATCAT[G/A]
CGGGATACTTAGGCTAAAGATCAATGCACGTGATTAGTGAAGATTCCATATGGCATACGATGGAGATATTGTGTGCGTATGGGATGCGGAGTCGAATTTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.40% 4.10% 5.27% 24.29% NA
All Indica  2759 62.80% 5.70% 6.85% 24.61% NA
All Japonica  1512 79.30% 0.10% 2.31% 18.25% NA
Aus  269 36.10% 8.20% 6.69% 49.07% NA
Indica I  595 47.40% 1.80% 9.92% 40.84% NA
Indica II  465 53.10% 0.40% 7.96% 38.49% NA
Indica III  913 80.40% 8.50% 3.29% 7.78% NA
Indica Intermediate  786 59.80% 8.50% 8.02% 23.66% NA
Temperate Japonica  767 83.20% 0.10% 2.35% 14.34% NA
Tropical Japonica  504 71.20% 0.20% 2.78% 25.79% NA
Japonica Intermediate  241 83.80% 0.00% 1.24% 14.94% NA
VI/Aromatic  96 42.70% 0.00% 7.29% 50.00% NA
Intermediate  90 74.40% 11.10% 0.00% 14.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127763517 C -> T LOC_Os11g45890.1 upstream_gene_variant ; 1870.0bp to feature; MODIFIER silent_mutation Average:25.982; most accessible tissue: Minghui63 young leaf, score: 58.21 N N N N
vg1127763517 C -> T LOC_Os11g45899.1 upstream_gene_variant ; 1414.0bp to feature; MODIFIER silent_mutation Average:25.982; most accessible tissue: Minghui63 young leaf, score: 58.21 N N N N
vg1127763517 C -> T LOC_Os11g45908.1 upstream_gene_variant ; 4486.0bp to feature; MODIFIER silent_mutation Average:25.982; most accessible tissue: Minghui63 young leaf, score: 58.21 N N N N
vg1127763517 C -> T LOC_Os11g45890-LOC_Os11g45899 intergenic_region ; MODIFIER silent_mutation Average:25.982; most accessible tissue: Minghui63 young leaf, score: 58.21 N N N N
vg1127763517 C -> DEL N N silent_mutation Average:25.982; most accessible tissue: Minghui63 young leaf, score: 58.21 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127763517 5.91E-06 5.90E-06 mr1153_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127763517 3.22E-07 1.70E-06 mr1172_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127763517 6.65E-06 6.65E-06 mr1303_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127763517 NA 7.15E-06 mr1358_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127763517 NA 2.75E-06 mr1376_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127763517 NA 8.48E-06 mr1386_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127763517 NA 2.84E-06 mr1431_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127763517 NA 2.98E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127763517 2.68E-06 1.01E-06 mr1550_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127763517 3.63E-06 1.21E-06 mr1555_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127763517 NA 7.54E-06 mr1562_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127763517 3.82E-06 3.82E-06 mr1978_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251