\
| Variant ID: vg1127763517 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 27763517 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CAAATTCGACTCCGCATCCCATACGCACACAATATCTCCATCGTATGCCATATGGAATCTTCACTAATCACGTGCATTGATCTTTAGCCTAAGTATCCCG[C/T]
ATGATATCTGACCGTCCAGACGTTACCTTATCTCCAAGTTGACTCCCGATCCATCACTAGCAATATTCTCCCGAGACATCAAGACACCTACACATGAATC
GATTCATGTGTAGGTGTCTTGATGTCTCGGGAGAATATTGCTAGTGATGGATCGGGAGTCAACTTGGAGATAAGGTAACGTCTGGACGGTCAGATATCAT[G/A]
CGGGATACTTAGGCTAAAGATCAATGCACGTGATTAGTGAAGATTCCATATGGCATACGATGGAGATATTGTGTGCGTATGGGATGCGGAGTCGAATTTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.40% | 4.10% | 5.27% | 24.29% | NA |
| All Indica | 2759 | 62.80% | 5.70% | 6.85% | 24.61% | NA |
| All Japonica | 1512 | 79.30% | 0.10% | 2.31% | 18.25% | NA |
| Aus | 269 | 36.10% | 8.20% | 6.69% | 49.07% | NA |
| Indica I | 595 | 47.40% | 1.80% | 9.92% | 40.84% | NA |
| Indica II | 465 | 53.10% | 0.40% | 7.96% | 38.49% | NA |
| Indica III | 913 | 80.40% | 8.50% | 3.29% | 7.78% | NA |
| Indica Intermediate | 786 | 59.80% | 8.50% | 8.02% | 23.66% | NA |
| Temperate Japonica | 767 | 83.20% | 0.10% | 2.35% | 14.34% | NA |
| Tropical Japonica | 504 | 71.20% | 0.20% | 2.78% | 25.79% | NA |
| Japonica Intermediate | 241 | 83.80% | 0.00% | 1.24% | 14.94% | NA |
| VI/Aromatic | 96 | 42.70% | 0.00% | 7.29% | 50.00% | NA |
| Intermediate | 90 | 74.40% | 11.10% | 0.00% | 14.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1127763517 | C -> T | LOC_Os11g45890.1 | upstream_gene_variant ; 1870.0bp to feature; MODIFIER | silent_mutation | Average:25.982; most accessible tissue: Minghui63 young leaf, score: 58.21 | N | N | N | N |
| vg1127763517 | C -> T | LOC_Os11g45899.1 | upstream_gene_variant ; 1414.0bp to feature; MODIFIER | silent_mutation | Average:25.982; most accessible tissue: Minghui63 young leaf, score: 58.21 | N | N | N | N |
| vg1127763517 | C -> T | LOC_Os11g45908.1 | upstream_gene_variant ; 4486.0bp to feature; MODIFIER | silent_mutation | Average:25.982; most accessible tissue: Minghui63 young leaf, score: 58.21 | N | N | N | N |
| vg1127763517 | C -> T | LOC_Os11g45890-LOC_Os11g45899 | intergenic_region ; MODIFIER | silent_mutation | Average:25.982; most accessible tissue: Minghui63 young leaf, score: 58.21 | N | N | N | N |
| vg1127763517 | C -> DEL | N | N | silent_mutation | Average:25.982; most accessible tissue: Minghui63 young leaf, score: 58.21 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1127763517 | 5.91E-06 | 5.90E-06 | mr1153_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127763517 | 3.22E-07 | 1.70E-06 | mr1172_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127763517 | 6.65E-06 | 6.65E-06 | mr1303_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127763517 | NA | 7.15E-06 | mr1358_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127763517 | NA | 2.75E-06 | mr1376_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127763517 | NA | 8.48E-06 | mr1386_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127763517 | NA | 2.84E-06 | mr1431_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127763517 | NA | 2.98E-06 | mr1482_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127763517 | 2.68E-06 | 1.01E-06 | mr1550_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127763517 | 3.63E-06 | 1.21E-06 | mr1555_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127763517 | NA | 7.54E-06 | mr1562_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127763517 | 3.82E-06 | 3.82E-06 | mr1978_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |