Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1127730356:

Variant ID: vg1127730356 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 27730356
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:

AAGAAAGCCTTATAGGTAATGTATGGTAGTTGGTTTTCTTTAATTTATTCTGCCTGTATATTACTAGGACCACCTGTTTCAGTATTAAATATTGCTTATT[G/A]
TCCTCTTGGATTTCTTTCTTCCAGGCATTCACAGAAGCAGTGCGTGTTTCCCAAATGGTCAGTCACAAGACTTGGTTCTTTCTCAAACTTGATTTTGTTT

Reverse complement sequence

AAACAAAATCAAGTTTGAGAAAGAACCAAGTCTTGTGACTGACCATTTGGGAAACACGCACTGCTTCTGTGAATGCCTGGAAGAAAGAAATCCAAGAGGA[C/T]
AATAAGCAATATTTAATACTGAAACAGGTGGTCCTAGTAATATACAGGCAGAATAAATTAAAGAAAACCAACTACCATACATTACCTATAAGGCTTTCTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	35.70%	27.20%	1.59%	35.46%	NA
All Indica	2759	37.30%	33.20%	1.59%	27.91%	NA
All Japonica	1512	36.80%	20.40%	0.73%	42.06%	NA
Aus	269	15.20%	10.80%	4.83%	69.14%	NA
Indica I	595	57.10%	16.50%	2.69%	23.70%	NA
Indica II	465	59.80%	10.50%	1.51%	28.17%	NA
Indica III	913	12.00%	57.90%	0.55%	29.46%	NA
Indica Intermediate	786	38.40%	30.40%	2.04%	29.13%	NA
Temperate Japonica	767	42.80%	14.90%	0.91%	41.46%	NA
Tropical Japonica	504	31.30%	24.60%	0.40%	43.65%	NA
Japonica Intermediate	241	29.00%	29.50%	0.83%	40.66%	NA
VI/Aromatic	96	21.90%	4.20%	5.21%	68.75%	NA
Intermediate	90	44.40%	33.30%	2.22%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1127730356	G -> A	LOC_Os11g45840.1	upstream_gene_variant ; 4216.0bp to feature; MODIFIER	silent_mutation	Average:28.734; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg1127730356	G -> A	LOC_Os11g45820.1	downstream_gene_variant ; 4073.0bp to feature; MODIFIER	silent_mutation	Average:28.734; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg1127730356	G -> A	LOC_Os11g45820-LOC_Os11g45840	intergenic_region ; MODIFIER	silent_mutation	Average:28.734; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N
vg1127730356	G -> DEL	N	N	silent_mutation	Average:28.734; most accessible tissue: Minghui63 panicle, score: 66.554	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1127730356	9.31E-06	1.44E-10	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127730356	6.34E-06	5.60E-08	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127730356	NA	6.58E-06	mr1057_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127730356	1.07E-06	NA	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127730356	NA	8.24E-10	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127730356	6.72E-07	NA	mr1667_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127730356	NA	1.68E-07	mr1667_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251