\
| Variant ID: vg1127730356 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 27730356 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 76. )
AAGAAAGCCTTATAGGTAATGTATGGTAGTTGGTTTTCTTTAATTTATTCTGCCTGTATATTACTAGGACCACCTGTTTCAGTATTAAATATTGCTTATT[G/A]
TCCTCTTGGATTTCTTTCTTCCAGGCATTCACAGAAGCAGTGCGTGTTTCCCAAATGGTCAGTCACAAGACTTGGTTCTTTCTCAAACTTGATTTTGTTT
AAACAAAATCAAGTTTGAGAAAGAACCAAGTCTTGTGACTGACCATTTGGGAAACACGCACTGCTTCTGTGAATGCCTGGAAGAAAGAAATCCAAGAGGA[C/T]
AATAAGCAATATTTAATACTGAAACAGGTGGTCCTAGTAATATACAGGCAGAATAAATTAAAGAAAACCAACTACCATACATTACCTATAAGGCTTTCTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 35.70% | 27.20% | 1.59% | 35.46% | NA |
| All Indica | 2759 | 37.30% | 33.20% | 1.59% | 27.91% | NA |
| All Japonica | 1512 | 36.80% | 20.40% | 0.73% | 42.06% | NA |
| Aus | 269 | 15.20% | 10.80% | 4.83% | 69.14% | NA |
| Indica I | 595 | 57.10% | 16.50% | 2.69% | 23.70% | NA |
| Indica II | 465 | 59.80% | 10.50% | 1.51% | 28.17% | NA |
| Indica III | 913 | 12.00% | 57.90% | 0.55% | 29.46% | NA |
| Indica Intermediate | 786 | 38.40% | 30.40% | 2.04% | 29.13% | NA |
| Temperate Japonica | 767 | 42.80% | 14.90% | 0.91% | 41.46% | NA |
| Tropical Japonica | 504 | 31.30% | 24.60% | 0.40% | 43.65% | NA |
| Japonica Intermediate | 241 | 29.00% | 29.50% | 0.83% | 40.66% | NA |
| VI/Aromatic | 96 | 21.90% | 4.20% | 5.21% | 68.75% | NA |
| Intermediate | 90 | 44.40% | 33.30% | 2.22% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1127730356 | G -> A | LOC_Os11g45840.1 | upstream_gene_variant ; 4216.0bp to feature; MODIFIER | silent_mutation | Average:28.734; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg1127730356 | G -> A | LOC_Os11g45820.1 | downstream_gene_variant ; 4073.0bp to feature; MODIFIER | silent_mutation | Average:28.734; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg1127730356 | G -> A | LOC_Os11g45820-LOC_Os11g45840 | intergenic_region ; MODIFIER | silent_mutation | Average:28.734; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg1127730356 | G -> DEL | N | N | silent_mutation | Average:28.734; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1127730356 | 9.31E-06 | 1.44E-10 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127730356 | 6.34E-06 | 5.60E-08 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127730356 | NA | 6.58E-06 | mr1057_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127730356 | 1.07E-06 | NA | mr1133_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127730356 | NA | 8.24E-10 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127730356 | 6.72E-07 | NA | mr1667_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127730356 | NA | 1.68E-07 | mr1667_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |