\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127730356:

Variant ID: vg1127730356 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 27730356
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 76. )

Flanking Sequence (100 bp) in Reference Genome:


AAGAAAGCCTTATAGGTAATGTATGGTAGTTGGTTTTCTTTAATTTATTCTGCCTGTATATTACTAGGACCACCTGTTTCAGTATTAAATATTGCTTATT[G/A]
TCCTCTTGGATTTCTTTCTTCCAGGCATTCACAGAAGCAGTGCGTGTTTCCCAAATGGTCAGTCACAAGACTTGGTTCTTTCTCAAACTTGATTTTGTTT

Reverse complement sequence

AAACAAAATCAAGTTTGAGAAAGAACCAAGTCTTGTGACTGACCATTTGGGAAACACGCACTGCTTCTGTGAATGCCTGGAAGAAAGAAATCCAAGAGGA[C/T]
AATAAGCAATATTTAATACTGAAACAGGTGGTCCTAGTAATATACAGGCAGAATAAATTAAAGAAAACCAACTACCATACATTACCTATAAGGCTTTCTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 35.70% 27.20% 1.59% 35.46% NA
All Indica  2759 37.30% 33.20% 1.59% 27.91% NA
All Japonica  1512 36.80% 20.40% 0.73% 42.06% NA
Aus  269 15.20% 10.80% 4.83% 69.14% NA
Indica I  595 57.10% 16.50% 2.69% 23.70% NA
Indica II  465 59.80% 10.50% 1.51% 28.17% NA
Indica III  913 12.00% 57.90% 0.55% 29.46% NA
Indica Intermediate  786 38.40% 30.40% 2.04% 29.13% NA
Temperate Japonica  767 42.80% 14.90% 0.91% 41.46% NA
Tropical Japonica  504 31.30% 24.60% 0.40% 43.65% NA
Japonica Intermediate  241 29.00% 29.50% 0.83% 40.66% NA
VI/Aromatic  96 21.90% 4.20% 5.21% 68.75% NA
Intermediate  90 44.40% 33.30% 2.22% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127730356 G -> A LOC_Os11g45840.1 upstream_gene_variant ; 4216.0bp to feature; MODIFIER silent_mutation Average:28.734; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg1127730356 G -> A LOC_Os11g45820.1 downstream_gene_variant ; 4073.0bp to feature; MODIFIER silent_mutation Average:28.734; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg1127730356 G -> A LOC_Os11g45820-LOC_Os11g45840 intergenic_region ; MODIFIER silent_mutation Average:28.734; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg1127730356 G -> DEL N N silent_mutation Average:28.734; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127730356 9.31E-06 1.44E-10 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127730356 6.34E-06 5.60E-08 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127730356 NA 6.58E-06 mr1057_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127730356 1.07E-06 NA mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127730356 NA 8.24E-10 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127730356 6.72E-07 NA mr1667_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127730356 NA 1.68E-07 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251