\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127729025:

Variant ID: vg1127729025 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 27729025
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, G: 0.12, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


ATGTCTTGCTGTACACCTTCTATTAATTGCCTTTTTATACTCACATTGTCATTCAAATGATATATTGTGTTTGATTTATGTATGTCAACATGATTCCTCA[G/C]
TGACATGCGCCTAGGCCATTAACACCCGTGACCACCGTTGCAAGGCTGGGCGCCCTAATGAGGCCGGCGCCATCAACACATGGAAAGTCTGCCCATCCTC

Reverse complement sequence

GAGGATGGGCAGACTTTCCATGTGTTGATGGCGCCGGCCTCATTAGGGCGCCCAGCCTTGCAACGGTGGTCACGGGTGTTAATGGCCTAGGCGCATGTCA[C/G]
TGAGGAATCATGTTGACATACATAAATCAAACACAATATATCATTTGAATGACAATGTGAGTATAAAAAGGCAATTAATAGAAGGTGTACAGCAAGACAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 30.70% 27.80% 2.09% 39.40% NA
All Indica  2759 34.40% 31.00% 2.79% 31.86% NA
All Japonica  1512 28.30% 26.30% 0.66% 44.78% NA
Aus  269 10.40% 10.40% 3.72% 75.46% NA
Indica I  595 50.60% 8.40% 7.56% 33.45% NA
Indica II  465 56.60% 7.70% 0.65% 35.05% NA
Indica III  913 12.20% 59.10% 0.77% 27.93% NA
Indica Intermediate  786 34.90% 29.00% 2.80% 33.33% NA
Temperate Japonica  767 27.60% 25.00% 0.78% 46.54% NA
Tropical Japonica  504 30.00% 24.80% 0.79% 44.44% NA
Japonica Intermediate  241 27.00% 33.20% 0.00% 39.83% NA
VI/Aromatic  96 12.50% 4.20% 1.04% 82.29% NA
Intermediate  90 35.60% 36.70% 1.11% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127729025 G -> DEL N N silent_mutation Average:36.674; most accessible tissue: Minghui63 flag leaf, score: 75.722 N N N N
vg1127729025 G -> C LOC_Os11g45820.1 downstream_gene_variant ; 2742.0bp to feature; MODIFIER silent_mutation Average:36.674; most accessible tissue: Minghui63 flag leaf, score: 75.722 N N N N
vg1127729025 G -> C LOC_Os11g45820-LOC_Os11g45840 intergenic_region ; MODIFIER silent_mutation Average:36.674; most accessible tissue: Minghui63 flag leaf, score: 75.722 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127729025 4.43E-06 4.43E-06 mr1041 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127729025 9.31E-06 1.44E-10 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127729025 6.34E-06 5.60E-08 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127729025 NA 8.24E-10 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127729025 3.40E-06 NA mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127729025 NA 1.68E-07 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251