Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127729025:

Variant ID: vg1127729025 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 27729025
Reference Allele: G	Alternative Allele: C
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, G: 0.12, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:

ATGTCTTGCTGTACACCTTCTATTAATTGCCTTTTTATACTCACATTGTCATTCAAATGATATATTGTGTTTGATTTATGTATGTCAACATGATTCCTCA[G/C]
TGACATGCGCCTAGGCCATTAACACCCGTGACCACCGTTGCAAGGCTGGGCGCCCTAATGAGGCCGGCGCCATCAACACATGGAAAGTCTGCCCATCCTC

Reverse complement sequence

GAGGATGGGCAGACTTTCCATGTGTTGATGGCGCCGGCCTCATTAGGGCGCCCAGCCTTGCAACGGTGGTCACGGGTGTTAATGGCCTAGGCGCATGTCA[C/G]
TGAGGAATCATGTTGACATACATAAATCAAACACAATATATCATTTGAATGACAATGTGAGTATAAAAAGGCAATTAATAGAAGGTGTACAGCAAGACAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	30.70%	27.80%	2.09%	39.40%	NA
All Indica	2759	34.40%	31.00%	2.79%	31.86%	NA
All Japonica	1512	28.30%	26.30%	0.66%	44.78%	NA
Aus	269	10.40%	10.40%	3.72%	75.46%	NA
Indica I	595	50.60%	8.40%	7.56%	33.45%	NA
Indica II	465	56.60%	7.70%	0.65%	35.05%	NA
Indica III	913	12.20%	59.10%	0.77%	27.93%	NA
Indica Intermediate	786	34.90%	29.00%	2.80%	33.33%	NA
Temperate Japonica	767	27.60%	25.00%	0.78%	46.54%	NA
Tropical Japonica	504	30.00%	24.80%	0.79%	44.44%	NA
Japonica Intermediate	241	27.00%	33.20%	0.00%	39.83%	NA
VI/Aromatic	96	12.50%	4.20%	1.04%	82.29%	NA
Intermediate	90	35.60%	36.70%	1.11%	26.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1127729025	G -> DEL	N	N	silent_mutation	Average:36.674; most accessible tissue: Minghui63 flag leaf, score: 75.722	N	N	N	N
vg1127729025	G -> C	LOC_Os11g45820.1	downstream_gene_variant ; 2742.0bp to feature; MODIFIER	silent_mutation	Average:36.674; most accessible tissue: Minghui63 flag leaf, score: 75.722	N	N	N	N
vg1127729025	G -> C	LOC_Os11g45820-LOC_Os11g45840	intergenic_region ; MODIFIER	silent_mutation	Average:36.674; most accessible tissue: Minghui63 flag leaf, score: 75.722	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1127729025	4.43E-06	4.43E-06	mr1041	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127729025	9.31E-06	1.44E-10	mr1133	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127729025	6.34E-06	5.60E-08	mr1667	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127729025	NA	8.24E-10	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127729025	3.40E-06	NA	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127729025	NA	1.68E-07	mr1667_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251