\
| Variant ID: vg1127729025 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 27729025 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.88, G: 0.12, others allele: 0.00, population size: 89. )
ATGTCTTGCTGTACACCTTCTATTAATTGCCTTTTTATACTCACATTGTCATTCAAATGATATATTGTGTTTGATTTATGTATGTCAACATGATTCCTCA[G/C]
TGACATGCGCCTAGGCCATTAACACCCGTGACCACCGTTGCAAGGCTGGGCGCCCTAATGAGGCCGGCGCCATCAACACATGGAAAGTCTGCCCATCCTC
GAGGATGGGCAGACTTTCCATGTGTTGATGGCGCCGGCCTCATTAGGGCGCCCAGCCTTGCAACGGTGGTCACGGGTGTTAATGGCCTAGGCGCATGTCA[C/G]
TGAGGAATCATGTTGACATACATAAATCAAACACAATATATCATTTGAATGACAATGTGAGTATAAAAAGGCAATTAATAGAAGGTGTACAGCAAGACAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 30.70% | 27.80% | 2.09% | 39.40% | NA |
| All Indica | 2759 | 34.40% | 31.00% | 2.79% | 31.86% | NA |
| All Japonica | 1512 | 28.30% | 26.30% | 0.66% | 44.78% | NA |
| Aus | 269 | 10.40% | 10.40% | 3.72% | 75.46% | NA |
| Indica I | 595 | 50.60% | 8.40% | 7.56% | 33.45% | NA |
| Indica II | 465 | 56.60% | 7.70% | 0.65% | 35.05% | NA |
| Indica III | 913 | 12.20% | 59.10% | 0.77% | 27.93% | NA |
| Indica Intermediate | 786 | 34.90% | 29.00% | 2.80% | 33.33% | NA |
| Temperate Japonica | 767 | 27.60% | 25.00% | 0.78% | 46.54% | NA |
| Tropical Japonica | 504 | 30.00% | 24.80% | 0.79% | 44.44% | NA |
| Japonica Intermediate | 241 | 27.00% | 33.20% | 0.00% | 39.83% | NA |
| VI/Aromatic | 96 | 12.50% | 4.20% | 1.04% | 82.29% | NA |
| Intermediate | 90 | 35.60% | 36.70% | 1.11% | 26.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1127729025 | G -> DEL | N | N | silent_mutation | Average:36.674; most accessible tissue: Minghui63 flag leaf, score: 75.722 | N | N | N | N |
| vg1127729025 | G -> C | LOC_Os11g45820.1 | downstream_gene_variant ; 2742.0bp to feature; MODIFIER | silent_mutation | Average:36.674; most accessible tissue: Minghui63 flag leaf, score: 75.722 | N | N | N | N |
| vg1127729025 | G -> C | LOC_Os11g45820-LOC_Os11g45840 | intergenic_region ; MODIFIER | silent_mutation | Average:36.674; most accessible tissue: Minghui63 flag leaf, score: 75.722 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1127729025 | 4.43E-06 | 4.43E-06 | mr1041 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127729025 | 9.31E-06 | 1.44E-10 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127729025 | 6.34E-06 | 5.60E-08 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127729025 | NA | 8.24E-10 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127729025 | 3.40E-06 | NA | mr1667_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127729025 | NA | 1.68E-07 | mr1667_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |