\
| Variant ID: vg1127723741 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 27723741 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.60, A: 0.40, others allele: 0.00, population size: 50. )
GTGTGTTTATTTCACGTCAAAATTGAAAGTTTGGTTGAAATTGGAACGATGCGACGGAAAAGTTCGAAATTTAACACCATATGTGTACAAAAATTTTGAT[G/A]
TGATAGAAAAATTAAAAGTTCGAAGAAAAAGTTTGTAACTAAACTTGGCCTAGGTTGTTTTTTTTGGATGGCGTAGGTTGTTTTTTTTTTTTTTATGGAG
CTCCATAAAAAAAAAAAAAACAACCTACGCCATCCAAAAAAAACAACCTAGGCCAAGTTTAGTTACAAACTTTTTCTTCGAACTTTTAATTTTTCTATCA[C/T]
ATCAAAATTTTTGTACACATATGGTGTTAAATTTCGAACTTTTCCGTCGCATCGTTCCAATTTCAACCAAACTTTCAATTTTGACGTGAAATAAACACAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.70% | 17.60% | 0.53% | 28.18% | NA |
| All Indica | 2759 | 48.90% | 23.50% | 0.47% | 27.15% | NA |
| All Japonica | 1512 | 68.30% | 10.50% | 0.46% | 20.70% | NA |
| Aus | 269 | 27.90% | 0.70% | 1.12% | 70.26% | NA |
| Indica I | 595 | 54.80% | 5.20% | 1.18% | 38.82% | NA |
| Indica II | 465 | 60.90% | 6.90% | 0.22% | 32.04% | NA |
| Indica III | 913 | 38.30% | 48.30% | 0.11% | 13.25% | NA |
| Indica Intermediate | 786 | 49.50% | 18.40% | 0.51% | 31.55% | NA |
| Temperate Japonica | 767 | 74.70% | 7.30% | 0.26% | 17.73% | NA |
| Tropical Japonica | 504 | 52.40% | 18.30% | 0.99% | 28.37% | NA |
| Japonica Intermediate | 241 | 81.30% | 4.60% | 0.00% | 14.11% | NA |
| VI/Aromatic | 96 | 30.20% | 2.10% | 2.08% | 65.62% | NA |
| Intermediate | 90 | 60.00% | 20.00% | 0.00% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1127723741 | G -> A | LOC_Os11g45820.1 | upstream_gene_variant ; 95.0bp to feature; MODIFIER | silent_mutation | Average:38.197; most accessible tissue: Callus, score: 92.943 | N | N | N | N |
| vg1127723741 | G -> A | LOC_Os11g45809.1 | downstream_gene_variant ; 2641.0bp to feature; MODIFIER | silent_mutation | Average:38.197; most accessible tissue: Callus, score: 92.943 | N | N | N | N |
| vg1127723741 | G -> A | LOC_Os11g45809-LOC_Os11g45820 | intergenic_region ; MODIFIER | silent_mutation | Average:38.197; most accessible tissue: Callus, score: 92.943 | N | N | N | N |
| vg1127723741 | G -> DEL | N | N | silent_mutation | Average:38.197; most accessible tissue: Callus, score: 92.943 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1127723741 | NA | 6.26E-06 | mr1044 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127723741 | 2.71E-06 | NA | mr1133 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127723741 | NA | 1.39E-08 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127723741 | 3.36E-06 | 6.53E-07 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127723741 | 4.81E-08 | NA | mr1133_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127723741 | NA | 1.06E-08 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127723741 | 3.98E-06 | NA | mr1667_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127723741 | NA | 8.10E-07 | mr1667_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |