\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1127696861:

Variant ID: vg1127696861 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 27696861
Reference Allele: GAlternative Allele: T,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGGCTAGCGTCGCTGGTGTGCGAGCAGTCCACACGAGTTCGATTTCTGGGATCGCAACTCGCGTGTCTCACCTAGCTAGGGTTTTTCCCTGTTTTCCCTA[G/T,A]
GATCAATTTTGGTTGGTCCTGGTTAGAAAATAGGGTACACACGTGGGTGCTTCAGTGGGAATACACGTTTCCCGTGCACTGAGGCTTAGTGCCTCCTAGG

Reverse complement sequence

CCTAGGAGGCACTAAGCCTCAGTGCACGGGAAACGTGTATTCCCACTGAAGCACCCACGTGTGTACCCTATTTTCTAACCAGGACCAACCAAAATTGATC[C/A,T]
TAGGGAAAACAGGGAAAAACCCTAGCTAGGTGAGACACGCGAGTTGCGATCCCAGAAATCGAACTCGTGTGGACTGCTCGCACACCAGCGACGCTAGCCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.80% 4.50% 0.30% 10.45% A: 0.02%
All Indica  2759 83.00% 7.40% 0.36% 9.21% NA
All Japonica  1512 91.80% 0.10% 0.26% 7.80% A: 0.07%
Aus  269 62.10% 0.00% 0.00% 37.92% NA
Indica I  595 62.90% 29.20% 0.34% 7.56% NA
Indica II  465 88.40% 0.20% 0.22% 11.18% NA
Indica III  913 92.60% 0.40% 0.33% 6.68% NA
Indica Intermediate  786 84.10% 3.20% 0.51% 12.21% NA
Temperate Japonica  767 97.90% 0.10% 0.26% 1.56% A: 0.13%
Tropical Japonica  504 81.20% 0.00% 0.40% 18.45% NA
Japonica Intermediate  241 94.60% 0.00% 0.00% 5.39% NA
VI/Aromatic  96 85.40% 0.00% 0.00% 14.58% NA
Intermediate  90 86.70% 6.70% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1127696861 G -> T LOC_Os11g45750.1 upstream_gene_variant ; 1791.0bp to feature; MODIFIER silent_mutation Average:79.069; most accessible tissue: Zhenshan97 panicle, score: 91.03 N N N N
vg1127696861 G -> T LOC_Os11g45770.1 downstream_gene_variant ; 1115.0bp to feature; MODIFIER silent_mutation Average:79.069; most accessible tissue: Zhenshan97 panicle, score: 91.03 N N N N
vg1127696861 G -> T LOC_Os11g45780.1 downstream_gene_variant ; 4209.0bp to feature; MODIFIER silent_mutation Average:79.069; most accessible tissue: Zhenshan97 panicle, score: 91.03 N N N N
vg1127696861 G -> T LOC_Os11g45770-LOC_Os11g45780 intergenic_region ; MODIFIER silent_mutation Average:79.069; most accessible tissue: Zhenshan97 panicle, score: 91.03 N N N N
vg1127696861 G -> A LOC_Os11g45750.1 upstream_gene_variant ; 1791.0bp to feature; MODIFIER silent_mutation Average:79.069; most accessible tissue: Zhenshan97 panicle, score: 91.03 N N N N
vg1127696861 G -> A LOC_Os11g45770.1 downstream_gene_variant ; 1115.0bp to feature; MODIFIER silent_mutation Average:79.069; most accessible tissue: Zhenshan97 panicle, score: 91.03 N N N N
vg1127696861 G -> A LOC_Os11g45780.1 downstream_gene_variant ; 4209.0bp to feature; MODIFIER silent_mutation Average:79.069; most accessible tissue: Zhenshan97 panicle, score: 91.03 N N N N
vg1127696861 G -> A LOC_Os11g45770-LOC_Os11g45780 intergenic_region ; MODIFIER silent_mutation Average:79.069; most accessible tissue: Zhenshan97 panicle, score: 91.03 N N N N
vg1127696861 G -> DEL N N silent_mutation Average:79.069; most accessible tissue: Zhenshan97 panicle, score: 91.03 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1127696861 G A -0.08 -0.03 -0.02 -0.06 -0.06 -0.04
vg1127696861 G T -0.04 -0.05 -0.02 -0.05 -0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1127696861 1.23E-06 NA mr1234 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127696861 NA 5.85E-06 mr1592 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1127696861 NA 8.23E-06 mr1921 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251