\
| Variant ID: vg1127682350 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 27682350 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GGCTGCGATCAGGATCGGCAGAGTTCGAGTCGGACTAGGTAGCCGATTGAGCCGATTCCGATAATGTGACTCGGTATTCGTTATCGGGTTGAGTTAATGT[G/A]
CTTCATATGGATTGCCACGCACGGATTGAGTCCTGAGAAGGCAATTGTATCTATTAATTAGGATATTTTATGTAATTTTTTTAGAGATAAGTTTGGGCAA
TTGCCCAAACTTATCTCTAAAAAAATTACATAAAATATCCTAATTAATAGATACAATTGCCTTCTCAGGACTCAATCCGTGCGTGGCAATCCATATGAAG[C/T]
ACATTAACTCAACCCGATAACGAATACCGAGTCACATTATCGGAATCGGCTCAATCGGCTACCTAGTCCGACTCGAACTCTGCCGATCCTGATCGCAGCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 21.60% | 0.10% | 11.98% | 66.27% | NA |
| All Indica | 2759 | 20.40% | 0.10% | 16.93% | 62.60% | NA |
| All Japonica | 1512 | 26.60% | 0.00% | 1.85% | 71.56% | NA |
| Aus | 269 | 10.40% | 1.10% | 19.70% | 68.77% | NA |
| Indica I | 595 | 25.00% | 0.00% | 21.85% | 53.11% | NA |
| Indica II | 465 | 11.20% | 0.00% | 22.58% | 66.24% | NA |
| Indica III | 913 | 20.00% | 0.20% | 12.38% | 67.36% | NA |
| Indica Intermediate | 786 | 22.80% | 0.00% | 15.14% | 62.09% | NA |
| Temperate Japonica | 767 | 35.60% | 0.00% | 1.56% | 62.84% | NA |
| Tropical Japonica | 504 | 8.90% | 0.00% | 2.38% | 88.69% | NA |
| Japonica Intermediate | 241 | 34.90% | 0.00% | 1.66% | 63.49% | NA |
| VI/Aromatic | 96 | 8.30% | 0.00% | 11.46% | 80.21% | NA |
| Intermediate | 90 | 24.40% | 0.00% | 7.78% | 67.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1127682350 | G -> A | LOC_Os11g45750.1 | downstream_gene_variant ; 1403.0bp to feature; MODIFIER | silent_mutation | Average:12.917; most accessible tissue: Callus, score: 32.926 | N | N | N | N |
| vg1127682350 | G -> A | LOC_Os11g45750.2 | downstream_gene_variant ; 1290.0bp to feature; MODIFIER | silent_mutation | Average:12.917; most accessible tissue: Callus, score: 32.926 | N | N | N | N |
| vg1127682350 | G -> A | LOC_Os11g45740-LOC_Os11g45750 | intergenic_region ; MODIFIER | silent_mutation | Average:12.917; most accessible tissue: Callus, score: 32.926 | N | N | N | N |
| vg1127682350 | G -> DEL | N | N | silent_mutation | Average:12.917; most accessible tissue: Callus, score: 32.926 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1127682350 | NA | 5.76E-06 | mr1212 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127682350 | NA | 6.68E-08 | mr1559 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1127682350 | NA | 3.00E-06 | mr1806_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |